Go find 5 materials that's u can use in ur garden.
Please answer. ​

Answers

Answer 1

Answer:

Soil knife to make digging the soil easierHandheld pruners to fix and prune the plants of your gardenGloves to keep your hands save from any harmful or chemical substance.Binder twine to maintain the plants (to tie their stems together)A notepad and pen to check the progress of your plants (e.g.: you might need to note down whether a plant may need more water or nutrients (mineral ions), if you see a plant almost wilting, appropriate actions must be taken so notepad and pen can help you track this down, so that you can get the appropriate resources needed)

(Done with the help of goxogle, but summarized, check full website here: https://gbbg.org/2020/03/5-tools-garden-bag/ )


Related Questions

Construct an argumentative paragraph. Do you believe it's ethical or unethical to artificially select traits in plants and or animals? Provide evidenco to suoport your claims. It doesn't matter what side you chose, but I need it asap.​I will give you any mark you want.​

Answers

Answer:

The ethics of artificially inserting traits in animals has been in the practice for years in the form of selective breeding, but should scientists really be editing DNA to the extent they are today? I don't believe they should. Life itself should construct itself without us interfering. Making a brand new plant just because it looks nice doesn't account for many factors, including the fact that it could be harmful to nearby plants if pollinated. In addition, generic engineering costs quite a lot of money, which should be used on other more cost effective methods, such as improving agriculture rather than creating a whole new plant that could harm entire crops. Genetic engineering isn't a necessity and humans should not play God with plant and animal life.

What does the temporal lobe and Cerebellum do?

Answers

Answer:

The temporal lobes are also believed to play an important role in processing affect/emotions, language, and certain aspects of visual perception.

The cerebellum is busy planning, adjusting and executing movements of the body, the limbs and the eyes.

Explanation:

What is the universe made of

Answers

Answer:

composition

Explanation:

the universe is composed almost completely of dark energy, dark matter , and ordinary matter

Answer: matter , atoms

Explanation:

The vocal cords stretch across the opening of the larynx. True or false??

Answers

Answer:

True

Explanation:

Vocal cords are bands of smooth muscle tissue located in the larynx. When air passes through, the vocal cords vibrate.

Answer: True

Explanation:

The vocal folds, also known popularly as vocal cords, are composed of twin infoldings of mucous membrane stretched horizontally across the larynx. They vibrate, modulating the flow of air being expelled from the lungs during phonation.

I hit a substance with a hammer and it shatters.It is a

Answers

Answer:

non metal ,so it is brittle in nature

Fill in the blanks the world banks the word bank is on the picture provided below :)

Answers

Answer:

1 is pioneer species 2 is limiting factor 3 is ecological succession

Explanation:

Answer:

1) pioneer

2) limiting factor

3) ecological succession

The sun converts nuclear energy into what type of energy?

Answers

Answer:

i would say chemical but if im wrong im super sorry!!

Explanation:

PLEASE ANSWER ALL QUESTIONS! THANKS!

Which of the following statements about salinity is true?
Question 1 options:

Ocean water near areas with low evaporation has higher salinity.


Ocean water in regions with high levels of precipitation has higher salinity.


Ocean water near rivers has a lower salinity.


Ocean water in areas with high humidity has a higher salinity



How are latitude and temperature related?








Question 2 options:

Lower latitudes will have warmer water because it is closer to the equator.


Higher latitudes will have warmer water because it is closer to the equator.


Higher latitudes will have warmer water because it is closer to the poles.


Lower latitudes will have warmer water because it is closer to the poles


How does salinity vary with freezing and melting?









Question 3 options:

Both freezing and melting decrease salinity.


Both freezing and melting increase salinity.


Freezing decreases salinity, while melting increases salinity.


Freezing increases salinity, while melting decreases salinity.


How does salinity vary with evaporation?









Question 4 options:

When water evaporates, it takes salt with it, increasing its salinity.


When water evaporates, it leaves salt behind, increasing its salinity.


When water evaporates, it leaves salt behind, decreasing its salinity.


When water evaporates, it takes salt with it, decreasing its salinity.

Answers

Answer:

that guys answers are all wrong except for #3

Explanation:

i took the quiz and got 1/4

Which feature of chytrids makes them different from the other types of fungi? the material that strengthens their cell walls the special digestive material they release their use of budding to reproduce their ability to live in dry environments

Answers

Answer:

the material that strengthens their cell walls

Explanation:

Chytrids originate from the kingdom fungi and a division known as Chytridiomycota. They contain a feature of unique characteristics by the presence of the chitin and the cellulose cell wall. The chitin made up the component of their cell wall in fungi but in Chytrids, the cellulose helps to strengthens their cell walls.

Answer:

A. the material that strengthens their cell walls

PLEASE HELP
Match the monomer to the polymer.
A.Amino acid B.glycogen
C. Nucleotide.
D.phospholipid Monosaccharide.
E.DNA
F.Fatty acids and glycerol.
G.protein collagen​

Answers

Nucleotide (DNA)

Amino acid (protein collagen​)

Monosaccharide (glycogen)

Fatty acids and glycerol (phospholipid)

A cell containing 20 chromosomes undergoes mitosis, each daughter cell will have 20 chromosomes
a.True
b.False

Answers

Answer:

the answer is true because a cell containing 20 chromosomes undergoes mitosis, each daughter cell will have 20 chromosomes

Please help!!!! Grizzly bears and polar bears are very closely related, so much so that they can reproduce to form hybrid offspring. Use your understanding of natural selection to describe how polar bears became a separate classification from the grizzly.

Answers

Scientists believe that at first these bears scavenged seal carcasses that had washed ashore, and gradually began to hunt the seals by waiting at the water's edge as the seals surfaced to breathe. This is believed to be an important step in the evolution of a new bear species, the polar bear

Over time the new polar bears were used to the cold climate and learnt how to fish, they then separated from the grizzly bears, they developed new creatures which would help them survive in one of the most dangerous climate.

Polar bears become separate classification from the grizzly by the natural selection known as divergent and adaptive evolutionary change.

Polar bears and grizzly bears are considered as closed to one another so they can interbreed. They both diverged from one another due to the harsh climate of the Arctic and the ecology of the region.

The changes that took place are camouflaging and pigment-free fur-coat that helped them in order to adapt to the different climates.The genetic mutation leads to such Adaptive changes when the polar bears migrated northwards.The populations living in different climates undergo natural selection that is divergent natural selection and the adaptive evolutionary changes that result in different species.

Learn more about speciation:

https://brainly.com/question/4493180

A friend says that all bacteria are harmful to people list three reasons this statement is incorrect.

Answers

-autotrophic bacteria give off oxygen (O2)
-flavor foods such as vinegar, yogurt, cheese, etc. (pasteurization)
-decomposers (bacteria)- recycle nutrients in food web
-enviromental clean-up- bacteria eat oil from oil spills
0health and medicine- bacteria break down food in your intestines/make

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

Help me please, I’m confused

Answers

Answer:

Photosynthesis-

Photosynthesis is a process used by plants and other organisms to convert light energy into chemical energy that, through cellular respiration, can later be released to fuel the organism's metabolic activities. Photosynthesis occurs in the chloroplast of a plant, which contains chlorophyll. In order for photosynthesis to take place, it needs to have water and carbon dioxide, the two very important raw materials necessary for this process. In the presence of carbon dioxide, such cells are able to convert this solar energy into energy-rich organic molecules, such as this energy-rich molecule known as glucose. Oxygen the by product of photosynthesis is inhaled by heterotrophs which aids in cellular respiration and other internal processes and then exhales carbon dioxide. ... In like manner, carbon dioxide passes from blood to the alveoli and exhaled after

Explanation:

How can you determine the number of bonds an atom can make

Answers

Answer:

The number of bonds for a neutral atom is equal to the number of electrons in the full valence shell (2 or 8 electrons) minus the number of valence electrons. This method works because each covalent bond that an atom forms adds another electron to an atoms valence shell without changing its charge.

I AM LITERALLY CRYING RIGHT NOW PLEASEE HELPPP WILL MARK BRANLIEST HELPPP MEE

Part 1: Explore

Based on your research and observations of the three common states of matter, answer the

following questions.

Out of the videos, animations, and images you researched, which was your favorite? Why?

Do you feel it accurately represented the differences between each state of matter


How does the space between the particles in each state of matter differ?

How do the particles in each state of matter move?

Part 2: Explain

Examine the heating curve of water below, and then answer the questions about it. If you require the use of a text reader, open the file Heating Curve of Water to receive the information.


Which three parts of the graph’s curve represent the solid, liquid, and gaseous state of water?

Explain your reasoning.

Which point of the graph’s curve represents the melting point of water? Explain your reasoning.

Which point of the graph’s curve represents the boiling point of water? Explain your reasoning.

What happens to the energy of water in Part B and Part D of the graph’s curve? How do you know?

Why does the temperature of the water stay the same when it melts and boils?

Now comes the hands-on part of your project! You will continue to explore phase changes by performing an experiment and creating your own heating curve. Before you begin your experiment, read over the following information.


The materials you will need for your experiment are listed below.


small pot

measuring cup (must have mL and oz markings)

spoon (wooden, plastic, or metal)

ice

water

stove

thermometer (should have units in °C

Time (min) Temperature of Water (°C) Observations of Water

0

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

Place 14 oz of crushed ice into a small pot. Then add about 125 mL of water to it.

Using the thermometer, measure and record the initial temperature of the ice water. List this temperature in °C in the “0” minutes row of your data table in the lab handout. *Do not allow the thermometer to touch the bottom of the pot when recording measurements.

Place the pot on the stove, and turn the knob to the medium-low setting.

Using the thermometer, measure the temperature every minute until the water begins to boil vigorously. Record this data in the table on your lab handout.

At each measurement, also record what is happening to the water. Be sure to record the times of these events:

The ice melts.

The water forms steam.

The water begins to boil.

Once the water has begun to boil, stir the water constantly with the spoon.

Continue to measure and record the temperature every minute until almost all the water has boiled and the pot is close to empty.

Record the last temperature, and turn off the stove. DO NOT TOUCH THE POT WITHOUT SAFETY EQUIPMENT.

Create the x-axis and y-axis of a graph.

Label the x-axis as follows: Time (min).

Label the y-axis as follows: Temperature of Water (°C).

Along the x-axis, create and label 15 marks, one for each minute of the experiment. (Hint: The origin starts at 0.)

Along the y-axis, create and label temperature markings for every 20 degrees. (Hint: The origin starts at 0.)

Refer to the data from your experiment to plot the points on your graph. Then connect each of the data points with a line.

Look over your graph to make sure it is clear and correctly labeled.

Either save your graph as a computer file, or take a picture of your graph and upload it as a file on your computer.

Describe your experience in performing the experiment. What went well? What could have been

improved?

Examine your line graph. How does the graph’s slope change over time?

Examine your line graph. Why does the slope change?

How could you apply the knowledge gained from this experiment in the real world?

Hint: Think of cooking.

Make a prediction. How do you think adding other substances to the water would affect its

heating curve?

THANK YOU SO MUCH

Answers

Answer:

think of cooking

Explanation:

the reason is that I just know it

explain how the cells, tissue, and organs within the circulatory system work together to enable it to perform its function of pumping materials around the body and removing waste products such as carbon dioxide.

Answers

Answer:

the body has levels of organization that build on each other.Cells make up tissues,tissues make up organs,and organs make up organs system.

HELP NEED THIS BY TODAY!
What did Mendel study that lead him to his discovery

Answers

Answer:

A monk, Mendel discovered the basic principles of heredity through experiments in his monastery's garden. His experiments showed that the inheritance of certain traits in pea plants follows particular patterns, subsequently becoming the foundation of modern genetics and leading to the study of heredity.

Explanation:

Answer:

Mendel studied the genetics of pea plants.

Explanation:

Mendel looked at the pea plants in his monastery garden to determine genetics. He found that some plants had white flowers, while some did not, and he used that discovery to determine the genetics of the plants.

WILL GIVE BRAINLIEST

DNA molecules are the instructions to make what?

-proteins

-carbohydrates

-lipids

-plasmids

Answers

Answer:

A

Explanation:

DNA is used to make mRNA, which is then used alongside tRNA to make a polypeptide chain. This chain folds to make a protein.

Consider two individuals that have the following genotypes: CCDd and Ccdd.
Predict the outcomes of a cross for these two individuals. What are the outcomes that could occur in the offspring? Select ALL that
apply.
A)
1/4 of the offspring will be CCdd.
B)
ccdd is not possible as an outcome of this cross,
All of the offspring will show the dominant trait for the allele.
D)
Only half of the offspring will show the dominant trait for the Dallele.
E)
All of the offspring will be heterozygous and will display the dominant
traits

Answers

Answer:

A,B,C,D

Explanation:

Since one parent is CC, there is no way to get cc as an outcome from this cross. However, there is also no way that all of the offspring will be CcDd, which is heterozygous for both traits. Therefore, this is the only answer choice that is incorrect.

As per observation about the  two individuals that have the following genotypes: CCDd and Ccdd the cross are options: a,b,c,d.

Since one parent is CC, there may be no manner to get cc as an final results from this cross. However, there may be additionally no manner that every one of the offspring could be CcDd, that is impure breed for each traits.

What is genotype ?

Genotype is an individual's series of genes. The time period can also talk to the 2 alleles inherited for a specific gene. The genotype is expressed while the statistics encoded within side the genes' DNA is used to make protein and RNA molecules.

Thus it is clear that all the observations are correct.

To learn about genotypes refer to the link ;

https://brainly.com/question/2235939

NEED HELP ITS DUE AFTER MY WINTER BREAK!

Answers

Answer:

For question 1 the answer is respiratory, and for question 2 is circulatory

Answer: (1) Circulatory (2) Respiratory

Name one adaptation that allows desert plants to survive with little water?

Answers

Answer:

stomata

Explanation:

This adaptation helps cacti reduce water loss by keeping the hot, dry wind from blowing directly across the stomata. The leaves and stems of many desert plants have a thick, waxy covering.

Which of the following options best depicts the process of protein synthesis?

1. protein → RNA → DNA
2. DNA → amino acid → RNA → protein
3. DNA → RNA → protein
4. RNA → DNA → RNA → protein

Answers

During translation, the genetic code in mRNA is read and used to make a protein. These two processes are summed up by the central dogma of molecular biology: DNA → RNA → Protein.

What are some factors that can cause observed evolutionary change?

Answers

Answer:

There are four such forces: mutation, gene flow, genetic drift, and natural selection.

Explanation:

Answer:

natural selection, random genetic drift, mutation, population mating structure, and culture.

Explanation:

I hope this helps! ^^

☁️☁️☁️☁️☁️☁️☁️☁️

Process performed by plants (producers) using the sun's energy to make their own food.
A. Conduction
B. Photosynthesis
C. Fission
D. Fusion

Answers

Answer: B.Fotosintesis

Explanation:

Answer:

option B

Explanation:

photosynthesis is the correct answer.

plz mark my answer as brainlist plzzzz.

hope this will be helpful to you.

Virtual Lab
Active
Create a dichotomous key.
O
Magnifying Glass
Drag your question here.
Legs
Wings
Antennae
Stinget
Claws
Please help

Answers

Answer:

WHAT ARE YOU TRYING TO ASK BRO

If one DNA strand reads CCGTAATGCAT, what will be the sequence of the complimentary strand?

Answers

The complimentary strand would be GGCATTACGTA

Which statement best explains how the gases of the atmosphere affect the temperature of Earth?

Answers

The atmosphere today contains more greenhouse gas molecules, so more of the infrared energy emitted by the surface ends up being absorbed by the atmosphere. Since some of the extra energy from a warmer atmosphere radiates back down to the surface, Earth's surface temperature rises.

Can someone help me with this chromosome assignment?

Answers

this is the answer for only first page.

homologous, diploid,gametes,haploid

the same thing as what the other person said.

di=2

hap=1

remember that for diploid and haploid

Other Questions
The senior classes at High School A and High School B planned separatetrips to the state fair. The senior class at High School A rented and filled 3vans and 13 buses with 628 students. High School B rented and filled 9vans and 2 buses with 182 students. Every van had the same number ofstudents in it as did the buses. Find the number of students in each vanand in each bus. *Van: 10, Bus: 46Van: 15, Bus: 70Van: 4, Bus: 22Van: 46, Bus: 10 Only one of the comparisons below is correct. Which is correct? What benchmark was used in your answer?ANSWERS ARE:2/3 Upon hearing of Juliet's "death," Romeo immediately buys deadly poison so he can die. From some readers' perspectives, his actions seem rash and poorly thought-out. However, considering the context of the play and your understanding of Romeo as a character, are his actions believable? Why or why not? 5(4x - 1.5x) + 12 = 4x - 2 7. Which regions of the world get most of their protein from cereal grain? Asking for a friend please help I will mark you brainliests help me with this please Can someone please help me ASAP expand the following: 4(2x + 1) CAN YOU READ THIS AMD IF YOU CAN HELP ME!!!!! THIS CRAZY I NEED PROFESSIONAL!!!!!!!!!!!!! n the diagram, the measure of angle 9 is 85.4 lines intersect to form 16 angles. The angles created, clockwise from top left are 1, 2, 3, 4; 5, 6, 7, 8; 9, 10, 11, 12; 13, 14, 15, 16.Which angle must also measure 85?Angle2Angle5Angle11Angle12 On Monday morning, Mr. Descartes asked his Algebra II students whether they had gone to the carnival in town over the weekend."I did," said Kristen. "I went on the Teacups ride twice, the rollercoaster twice, and the Spinning Vortex once. I had a lot of fun for only $20.""I went on those rides, too!" exclaimed Jorge. "Just once each on the Teacups and rollercoaster, but three times on the Spinning Vortex, all for $25.""I did five Teacup rides," said Lakesha. "And two rollercoaster rides, and one Spinning Vortex. I spent $29."Marc listed off the same rides. "Three Teacups for me, plus two rollercoasters, plus two rides on the Spinning Vortex, all for ""You don't need to say," interrupted Mr. Descartes. "I know how much you spent."How much are the rides? How much did Marc spend What happens during the pathway of glycolysis? A. Glucose is broken down into privateB. Carbon dioxide is produced C. More ATP is consumed than is produced. D. Lactic acid is produced What is the equivalent measure of 2.8 grams in hectograms? The electric field from two charges in the plane of the paper is represented by the dashed lines and arrows below.Select a response for each statement below. (Use 'North' towards top of page, and 'East' to the right)The magnitude of the E-field at Ris .... than at M.The force on a (+) test charge at P is zero.The magnitude of the charge on the left is .... that on the right.The force on a (+) test charge at L is directed ....The force on a (-) test charge at J is directedThe force on a (-) test charge at N is directed ....The sign of the charge on the right is negative. Many insects migrate (travel) between their summer and winter homes. The desert locust migrates about 800 miles farther than the Monarch butterfly every spring, and the pink-spotted hawk moth migrates about 200 miles less than four times the distance of the Monarch butterfly every spring. Laid end to end, the distances traveled by a Monarch butterfly, a desert locust, and a pink-spotted hawk moth is about 12600 miles every spring. How far does each species travel? The Psalms help teach us how to _____.A. PrayB. StudyC. Serve plz help!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! In a survey, 150 seventh graders said that they had been to a foreign country. That number represented 20% of the students who were surveyed. How many students were surveyed? Which of the following are prokaryotic cells?A) plantsB) fungiC) bacteriaD) animalsE) B and C only