Find the mass of a copper block with heat capacity 50j/kg,(specific heat capacity of copper=400j/kg)​

Answers

Answer 1

−1
C
−1
and L
f

=3.5×10
5
Jkg
−1

Mass of copper block m=2kg
Heat released by the copper block is equal to the heat gained by the ice to melt.
Let the mass of the ice melted be M.
Change in temperature of copper block ΔT=500−0=500
o
C
∴ mS(ΔT)=ML
f


Or 2×400×500=M×3.5×10
5

⟹ M=1.14kg
Answer 2
The person above me is right listen to then and stan fromis_9

Related Questions

How will Artificial Intelligence change the way we do things? .......C-Claim: 2 points
Write a statement that responds to the question.*
Your answer

Answers

Answer:

Well it'll change our way of knowledge and more than likely, labor type of jobs that need people will no longer need them, as they don't get hurt, you don't have to pay them or anything like a human being. We'll probably have school online, our shopping online. It'll be a both good and bad thing for us.

Explanation:

Artificial intelligence can help in many ways and will ruin things in many ways. But no matter what we need humans because robots do not make robots humans make the robots and the robots make things but not them selves. Also in today’s world artificial intelligence is changing the lives of millions by, taking peoples jobs away for something more easier and cheaper. The world is at the peak right now but if we do not take care of it it can make things worst than they already are.

Have a good day and a merry Christmas

A crate is being pulled down an incline as shown in the figure. With respect to the crate's direction of motion, which of the following forces does only negative work on the crate?

Answers

Answer: Fn

Explanation: Because Fn is applying force upward

In her lab, Mrs. Smith is pulling a 28 N block across a surface with a constant speed. If
she must pull with a force of 4.0 N, what is the coefficient of sliding friction between the
block and the lab table?

Answers

Answer:

0.14 is the friction coefficient.

Explanation:

The equation for the friction coefficient is friction coefficient = force/normal force. The force is 4N, and the normal force is 28N. 4/28=0.14.

Which of the following best describes the difference between type a and type b

Answers

Is there supposed to be a picture? Next time try putting a picture

2. Molly thinks, should I wear the red dress or the black dress. This is an example of ___________________.

A. self-concept
B. self-talk
C. self-disclosure
D. self-perception

Answers

Answer:

self concept

Explanation:

i think its self concept because she thinks

Explanation:

It is A. self concept. Because if I choose self talk I am talking to my self for example I made a mistake, I did something wrong etc.

If a 2kg ball rolls down a ramp that is 15 meters long in 25 seconds, what is the
average speed of the ball?
Will mark 5 stars!!!!!

Answers

Answer:

1.968504 ft/s

heres what
GIMBAP KIMCHI PORK BELLY look like

Answers

Answer:

OWOWOWOOWOWOWEO. PORK = PORK NOW GIOVE BRAINLIEST BC I SAID PORK = PORK

Explanation:

PLEASEEE HELPPP!!!!

A mover slides a refrigerator weighing 650 N at a constant velocity across the floor
a distance of 8.1 m. The force of friction between the refrigerator and the floor is
230 N. How much work has been performed by the mover on the refrigerator?

Answers

Answer: The work is 1863 N*m

Explanation:

We can define work as:

W = F*d

Where F is the force that the mover needs to apply to the refrigerator, and d is the distance that the refrigerator is moved.

To move the refrigerator, the minimal force that the mover needs to do is exactly the friction force (In this case, the refrigerator will move with constant speed).

Then we will have:

F = 230 N

and the distance is 8.1 meters, then the work will be:

W = 230N*8.1 m = 1863 N*m

How are speed and velocity similar?

Answers

Answer:

Speed and velocity are related in much the same way that distance and displacement are related. Speed is a scalar and velocity is a vector.

Please help!
A stone of mass 50 g is placed in a measuring
cylinder which contains some water.
The reading of the water level increases from
30 cm to 40 cm
What is the density of the stone?​

Answers

Answer:

Answer:

3 g/cm          

Explanation:

Mass of stone = 30 g

Initial volume of cylinder = 50 cm

Increased volume = 60 cm

Volume = 60-50

= 10 cm

Density of stone = Mass/Volume

= 30/10

= 3 g/ml            as 1 ml = 1 cm

= 3 g/ml          

Explanation:

Where would you find convergent and divergent plate boundaries relative to
convection currents in the mantle?

Answers

Answer:

When two tectonic plates meet, we get a “plate boundary.” There are three major types of plate boundaries, each associated with the formation of a variety of geologic features.

Explanation:

When the plates meet at the boundaries the convergent boundaries lie at the collision of two plates and the divergent lies near mid-oceanic ridges.

What are plate boundaries?

The earth plate tectonics are divided into the three types of plates as convergent which is the destruction of crust and are found where the heavy and light plate comes and colloid with each other submerging the heavier plate into the mantel.

The divergent ones found near the mid-oceanic ridges are the formation of a new plate as the plates diverge away from the ridges.

Find out more information about the plate boundaries.

brainly.com/question/24519460

. What is the velocity of a free-
falling object after 5 seconds?
(Use 10 m/s2 for gravity.)

Answers

Answer:

vf = 50 m/s

Explanation:

The equation for this kinematic problem is:

vf = vi + at

We are given:

a = 10m/s^2

vi = 0m/s

t = 5 sec

vf = ?

Solve for final velocity:

vf = 0 + 10(5)

vf = 50 m/s

Melinda is taking a tour through a new city on the tour she walk there .40 miles south 0.65 miles east 0.78 miles north 1.24 miles west then 1.20 miles south at the end of the tour what is Melinda's displacement vector

Answers

Answer:

The displacement vector is  [tex]-0.59 \hat i -0.82 \hat j[/tex]

Explanation:

Taking East as positive x-axis having a unit vector [tex]\hat i[/tex] and North as positive y-axis having a unit vector [tex]\hat j[/tex].

So, west and south are in negative x and negative y  directions respectively.

As she walks 0.40 miles south, 0.65 miles east, 0.78 miles north, 1.24 miles west then 1.20 miles south.

Scaling 1 mile as 1 unit vector, so 1 mile east = 1 [tex]\hat i[/tex] and so on

Adding all the displacement vectors, we have

[tex]\vec {v} = -0.40 \hat j +0.65 \hat i + 0.78 \hat j -1.24 \hat i - 1.20 \hat j[/tex]

[tex]\vec {v} = -0.59 \hat i -0.82 \hat j[/tex]

Hence, the displacement vector is  [tex]-0.59 \hat i -0.82 \hat j[/tex]

12. The diameter of a circle is 2.42m. Calculate its
area in proper significant figure​

Answers

Answer:

A = 4.6 [m²]

Explanation:

The area of a circle can be calculated by means of the following equation.

[tex]A=\frac{\pi }{4} *D^{2}[/tex]

where:

A = area [m²]

D = diameter = 2.42 [m]

Now replacing:

[tex]A=\frac{\pi }{4} *(2.42)^{2} \\A = 4.6 [m^{2} ][/tex]

9. A student notices that wearing darker colors in sunlight makes him feel warmer, so he decides to conduct an experiment. He takes five pieces of different
colored cloth and wraps
each one around a water bottle. He then places all five bottles in direct sunlight and measures the temperature of the water in each bottle an hour later
What is the dependent variable in this experiment?
O the time he leaves it in the sunlight
O the amount of water in each bottle
O the color of the cloth
O the temperature of the water

Answers

Answer: 4

Explanation:

The dependent variable is the temperature of the water.

What is the amount of space that a gas takes up called?
ASAP 20 points???

Answers

Answer:

Mass is the amount of matter an object has, and volume is the amount of space the matter takes up. Solids are easy to recognize. They have definite shape, mass, and volume. Trees are solids.

Explanation:

The amount of space occupied by a gas is called volume of the gas. The volume of a gas depends on the temperature and pressure.

What is volume ?

Volume is a physical parameter describing the space occupied  by a substance. Volume is an extensive property. Therefore, volume is dependent upon amount of the substance.

The total amount of a substance is called its mass. Density describes how closely its particles are packed in a given volume. Hence, volume is the ratio of mass to the density.

Volume of a gas changes with its temperature and pressure. As the pressure increases, volume increases whereas, as the temperature increase, volume increases.

Find more on volume:

https://brainly.com/question/13338592

#SPJ2

A football player at practice pushes a 80 kg blocking sled across the field at a constant speed. The coefficient of kinetic friction between the grass and the sled is 0.30. How much force must he apply to the sled

Answers

Answer:

The value is  [tex]F = 235.2 \ N[/tex]

Explanation:

From the question we are told that

   The mass of the sled is  [tex]m = 80 \ kg[/tex]

  The  coefficient of friction is  [tex]\mu = 0.30[/tex]

Generally the force that must be applied to the sled is equal to the frictional force experienced by the sled which is mathematically represented as

       [tex]F = m * \mu * g[/tex]

=>    [tex]F = 80 * 0.30 * 9.8[/tex]

=>    [tex]F = 235.2 \ N[/tex]

what is the meaning of habitat​

Answers

Answer: In ecology, habitat identifies as the array of resources, physical and biotic factors, present in an area that allow the survival and reproduction of a particular species. A species habitat can be seen as the physical manifestation of its ecological niche.

Explanation:

How do bubbles support the atomic theory?
A. The bubbles are lighter than air.
B. There is matter that cannot be seen inside the bubbles.
C. The bubbles will burst before long.
D. The bubbles cannot be broken into smaller pieces.

Answers

Answer:

The answer is probably B or C

Option B supports the atomic theory. Thus, this option is correct.

Atomic theory is the theory which states that matter is composed of particles called atoms. It tells us that all the matters are made of very tiny particles called atoms and all atoms of the same kind have the same size in any object.

Let's look at all the options given,

A-The bubbles are lighter than air- The bubble consists of water and air thus they are not lighter than air. This statement does not tell anything about the atomic theory. Hence this option is not correct.

B. There is a matter that cannot be seen inside the bubbles-The bubble is made up of two kinds of atoms one is oxygen and another is hydrogen. When we feel air into a soap bubble solution molecules want to attract to each other again so they wrap around the burst of air to attach to each other again. These atoms cannot be seen inside the bubbles but this option support the atomic theory. Thus, this option is correct.C. The bubbles will burst before long-In the bubble there is water. When this water loss in some way the bubble pops up. This water can be lost when it comes to contact with dry fingers or objects. It can be burst when the atmosphere is very dry. All the atoms are attracted towards.

D. The bubbles cannot be broken into smaller pieces-This option does not support the atomic theory thus this is not the correct option.

Hence the option B supports the atomic theory. Thus, this option is correct.

For more about the atoms follow the link below-

https://brainly.com/question/13981855

Two balloons are charged with an identical quantity and type of charge: -0.0025 C. They are held apart at a separation distance of 8 m. Determine the magnitude of the electrical force of repulsion between them.

Answers

Answer:

F = 878.9 N

Explanation:

The electrostatic force of attraction or repulsion is given by Coulomb's Law as follows:

F = kq₁q₂/r²

where,

F = Force pf repulsion between balloons = ?

k = Coulomb's Constant = 9 x 10⁹ N.m²/C²

q₁ = q₂ = magnitudes of 1st and 2nd charge = 0.0025 C

r = distance between balloons = 8 m

Therefore,

F = (9 x 10⁹ N.m²/C²)(0.0025 C)(0.0025 C)/(8 m)²

F = 878.9 N

The magnitude of the electrical force of repulsion between them is F = 878.9 N

Calculation of the magnitude of the electrical force:

Here we use Coulomb's Law

F = kq₁q₂/r²

Here,

F = Force of repulsion

k = Coulomb's Constant = 9 x 10⁹ N.m²/C²

q₁ = q₂ = magnitudes of 1st and 2nd charge = 0.0025 C

r = distance between balloons = 8 m

So,

F = (9 x 10⁹ N.m²/C²)(0.0025 C)(0.0025 C)/(8 m)²

F = 878.9 N

Hence, The magnitude of the electrical force of repulsion between them is F = 878.9 N

Learn more about force here: https://brainly.com/question/24758639

Qliestion 5 (1 point)
A car slows from 15.0 m/s to 5.0 m/s in 3.0s. What is the acceleration of the car?

Answers

Answer:

-3.33 ms^-2

Explanation:

Hope it helps

A psychologist wants to identify how the holiday season impacts the anxiety levels of Americans. She wants to get results on the feelings of anxiety from over one million Americans in the next month. What design should she use and why?

Answers

Answer: survey

Explanation:

A survey can be an interview or a questionnaire which is given to a particular group in order to know their characteristics or opinions, towards certain issues.

Since the psychologist wants to get results on the feelings of anxiety from over one million Americans in the next month, the survey should be used.

if wavelength and speed of a wave are 4 m and 332 m/s respectively, calculate its frequency

Answers

Explanation:

Given

wavelength = 4 m

speed = 332 m/s

frequency = ?

We know we have the formula

wavelength = speed / frequency

4 = 332 / frequency

frequency = 332/4

Therefore frequency is 83 Hertz .

mass does not vary from place to place why? ​

Answers

Answer:

It is always constant unlike weight

Weight is the mass of a system multiplied by the gravitational force exerted by the planet

Consider a 12.5 kg baby tiger in a tree has 490 J of gravitational potential energy. Determine the height of the tiger above the ground?

Answers

Answer:

[tex]\boxed {\boxed {\sf 4 \ meters}}[/tex]

Explanation:

Gravitational potential energy can be found using the following formula:

[tex]E_P=m*g*h[/tex]

where m is the mass, g is the gravitational acceleration, and h is the height.

The mass of the tiger is 12.5 kilograms. The gravitational acceleration on Earth is 9.8 m/s².

The potential energy is 490 Joules. Convert the units to simplify cancelling units later. 1 Joule is equal to 1 kilogram * meter² /second²Our answer of 490 J = 490 kg*m²/s²

[tex]m= 12.5 \ kg \\g= 9.8 \ m/s^2\\E_p= 490 \ kg*m^2/s^2[/tex]

Substitute the values into the formula.

[tex]490 \ kg*m^2/s^2 = 12.5 \ kg * 9.8 \ m/s^2 *h[/tex]

Multiply 12.5 kg and 9.8 m/s²

12.5 kg* 9.8 m/s² = 122.5 kg*m/s²

[tex]490 \ kg*m^2/s^2 = 122.5 \ kg *m/s^2 *h[/tex]

Since we are trying to solve for h, we must isolate it. Since h is being multiplied by 122.5, we must divide both sides by that number because the inverse of division is the inverse of multiplication.

[tex]\frac{490 \ kg*m^2/s^2} { 122.5 \ kg *m/s^2}= \frac{ 122.5 \ kg *m/s^2 *h }{ 122.5 \ kg *m/s^2}[/tex]

Note that when dividing, the kg*m/s² will cancel each other out, but a m (meter) will be left.

[tex]\frac{490 \ m }{122.5} =h[/tex]

[tex]4 \ m =h[/tex]

The tiger was 4 meters above the ground.

Martes
0-9 What is Acceleration due to Gravity? Explain formula of relation between g & G and
find the value of g.
Q-10 What are weeds? Give the examples of weeds, need to control them and methods
to control them.​

Answers

Explanation:

(9) Acceleration due to gravity is defined as the acceleration between two massive bodies when they are moving under free fall.

The relation between g and G is given by :

[tex]g=\dfrac{GM}{r^2}[/tex]

Where

G is universal gravitational constant

M is mass of the earth

r is distance

(10) The unwanted product that can toxify the crops are called weeds. To control weeds, a chemical called weedicides are sprayed in the field. Some other methods to control them are Ploughing or tilling of soil etc.

A 45 kg swimmer starting from rest can develop a maximum speed of 12 m/s over a distance of 20 m How much net force must be applied to do this ?

MUST SHOW WORK!

Answers


F = ma = mΔv/t = m(vf - vi)/t = mvf/t (since vi = 0)

⇒ a = vf/t


While accelerating from rest to vf, the distance d the swimmer traveled satisfies

d = (1/2)at2

Then

d = (1/2)(vf/t)t2 = vf t/2 ⇒

t = 2d/vf

F = ma = mvf/t = mvf / (2d/vf) = mvf2 / (2d)

F = [45 * 122 / (2 * 20)] N = 162 N

If you also want to know how long the swimmer took to accelerate to vf,

t = 2d/vf = (2 * 20 / 12) s = 3.33 s
55m got it right on edg

I’ll mark u as brainlist if you get this right!

Answers

It should be B: 2.0

Ethics are deliberately learned from the family. Please select the best answer from the choices provided

Answers

Answer:

what are the choices provided?

Explanation:

Answer:

True

Explanation:

On Edg

What measurement do we use to determine the amount of force used to move an object by a simple machine

Answers

Answer:

Newtons.

Explanation:

Force is given by the multiplication of mass and acceleration.

Mathematically, Force is;

[tex] F = ma[/tex]

Where;

F represents force measured in Newton.

m represents the mass of an object measured in kilograms.

a represents acceleration measured in meter per seconds square.

Newtons is a measurement we use to determine the amount of force used to move an object by a simple machine. It is the International System of Units (SI) used to measure force and has a symbol of N.

Basically, it was named after Sir Isaac Newton based on his fundamental works in the field of mechanics (motions).

Other Questions
251 pointWhich type of leadership makes the least use of delegation?O AuthoritarianLaissez-faireO Democratic What is the quotient of 1414 divided by 32 and written in a mixed fraction Someone help me I dont know if its globe or map 4 pleasee i have to submit in 10 minutes how do you spell 20k? A 0.0375B 6C 60D 600Can you help pleaseeee!! An archaeologist discovered a preserved mummy, hieroglyphicswritten on stone walls, and an embalmed pharaoh. In which river valleycivilization was this site most likely found? *a.Mesopotamiab. Indiac.Egyptd. China What is the measure of angle A?A.54B.60C.16.3662D.66E.126 which will cause an increase in runoff and infiltration in an area In IJK, K J, IJ = 9 and JK = 10. Find the length of KI. y-4=-2(x+3) what's the answer What would happen if a neutron was added to Lithium (7) 1. Why do the Japanese want to hire U.S. military generals? If you are working on doing senior portraits and want a lens that will give you the best shallow depth of field which lens would you choose?a) 55mm f1.2 (focal length of 55mm, maximum aperture of 1.2)b) 28-80mm f4.5 (Zoom lens with focal length from 28-80mm, max aperture 4.5)c) 18mm f5.6d) 50mm f1.445 points and brainliest I am having trouble with doing this code on Python:Develop the Car class by creating an attribute purchase_price (type int) and the method print_info() that outputs the car's information.Ex: If the input is:2011 18000 2018where 2011 is the car's model year, 18000 is the purchase price, and 2018 is the current year, then print_info() outputs:Car's information: Model year: 2011 Purchase price: 18000 Current value: 5770Note: print_info() should use three spaces for indentation. What rebellion proved that the Articles of Confederation was too weak to survive as a federal government? 2. Describe two ways you can personally helpminimize human impact on the atmosphere.SC.7.E.6.6 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo Do white even have a culture? Representing Relationships and Functionspls i need help