fill in the blanks......
the new cells that arise after cell division are called _____

Answers

Answer 1

Answer:

the new cells that arise after cell division are called daughter cells.


Related Questions

Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG
Match the words in the left column to the appropriate blanks in the sentences on the right.
The secondary structure given in the MaxExpect results can best be described as_________
Thus, the type of RNA is best classified as_________
a single strand with a distinctive cloverleaf structure
a single-stranded random coll
an unspecified type of RNA
rRNA
a single strand folded upon itself to form a small, round structure
tRNA

Answers

Answer:

The correct answer is -

a single strand with a distinctive cloverleaf structure, and

tRNA

Explanation:

The given sequence is RNA sequence as it contains uracil in the sequence instead of thymine. In this sequence, there are nucleotides under 100 so it's comparatively small for mRNA molecules.

Therefore it is a single-stranded RNA molecule with a distinctive cloverleaf structure which is a characteristic feature of the tRNA molecule that is used to make amino acids sequences with the help of mRNA during translation.

correct answer.
How many oxygen atoms does ozone consist of?
OA.
1:1
OB. 2:2
OC. 3:3
OD.
4:4
O E. 5:0
Reset
Next
Reset
Next

Answers

Answer:

C. 3:3

Explanation:

"Ozone is a gas that is naturally present in our atmosphere. Each ozone molecule contains three atoms of oxygen and is denoted chemically as O3. Ozone is found primarily in two regions of the atmosphere." https://csl.noaa.gov/assessments/ozone/2002/qandas1.pdf

How can you identify which organisms belong in which kingdom? Specifically, how can you
tell if it is a plant or an animal?

Answers

Living things are placed into certain kingdoms based on how they obtain their food, the types of cells that make up their body, and the number of cells they contain. The phylum is the next level following kingdom in the classification of living things.

HELP ASAP I WILL MARK BRAINLIEST PLS NO LINK I DONT WANT TO DO BAD ON THIS ASSIGMENT

The International Space Station (ISS) orbits Earth 254 miles above. It takes about 48 hours to get from Earth to the ISS. What is the average speed of the spacecraft? Round to the nearest hundredth (two decimal places).

Speed =​

Answers

Answer:

Speed= Distance Divided By Time

Distance= 254 Miles

Time= 48 Hours

Speed= 5.29 Approximately

Next >
Muscular Strength and Endurance: Mastery Test
4
Select the correct answer.
What must skeletal muscles do to move?
A.
engage their fibers slowly
В.
twitch involuntarily
Oc.
separate from the bone
O D.
contract and relax
Reset
Next

Answers

THE ANSWER IS B TWITCH INVOLUNTARY

What type of energy is a car’s engines gears?

Answers

Answer:

The internal combustion engine in the car converts the potential chemical energy in gasoline and oxygen into thermal energy which is transformed into the mechanical energy that accelerates the vehicle (increasing its kinetic energy) by causing the pressure and performing the work on the pistons.

Are Parakeets good starter pets? why or why not

Answers

Answer:

NO! They require a ton of attention, a large cage, and experience with birds. Parakeets are often marked as starter pets, but no, they are not.

First, they need a 3 feet long cage with 5+ toys that need to be changed each month. And they need natural perches, not the cheap wooden dowels, they will get feet problems. Most people don't do this, having a bored pet.

Second, parakeets will chew anything given/available to them, and a lot of things can be toxic to them, which can lead to the death of your pet.

Third, parakeets are messy and noisy. They poop a LOT and love to toss seeds around their cage. They also need millet and a calcium chew, which are also messy.

They also will want a friend, they are flock animals in the wild so 3-4 birds is a good number, but getting more birds means getting a large cage. The pet store will tell you it's fine, but it is not. ALWAYS SEEK HELP FROM A BIRD BREEDER.

Lastly, they need a bird proofed room to fly around in. No matter how large your cage is, they still need some out-of cage time.

Try a dove or pigeon instead, they are listen the #1 easiest and cheapest to care for pet bird.

Please help, its about Earth's oceans.

Answers

Answer:

The Correct awnser is D

Explanation:

Earth has 75% of our space is made up of water and most of it comes from our ocean.

BRAINLIEST PLEASE

A scientist exploring in the rainforest found an unclassified organism. It is multicellular and made of multiple thread-like structures. The organism has cells with a nucleus and a cell wall made of chitin. The scientist should classify this organism as belonging to the kingdom—

Answers

Answer:

Kingdom Fungi

Explanation:

Based on certain characteristics possessed by living organisms, they have been classified into five different kingdoms namely; plantae, animalia, monera, protista and fungi. Organisms with similar characteristics have been placed under the same kingdom.

Kingdom Fungi is a kingdom that contains organisms that possess characteristics different from plants and animals. Some of these features are those possessed by the unclassified organism found in the rainforest and they are as follows:

- They are eukaryotic (possess a true nucleus) and multicellular (have more than one cell).

- Their cell wall is made of chitin (a carbohydrate)

- They are made of multiple thread-like structures called HYPHAE.

Based on these mentioned characteristics above, the scientist should classify this organism as belonging to the kingdom FUNGI.

In pea plants, purple flowers (P) are dominant over white flowers (P). If two heterozygous purple flowered plants are
crossed with each other, then what are the possible genotypes of the offspring?
0
Answer is pp only

Answers

Answer :the answer is D

Explanation:

Convection occurs in earth’s atmosphere, oceans, and mantel

Answers

Answer:

what is the question?

Explanation:

Siblings will have the same nuclear DNA, but different mtDNA.
True
False

Answers

Answer:true

Explanation:

PLEASE HELP !!
ILL GIVE BRAINLIEST

NO LINKS OR FILES.

Answers

Answer:

I would say c because, sure the polar bears can swim and other things there will be very little ice once the ecosystem melts.

Explanation:

common sence

Alternative Energy Webquest Questions
Choose a form of alternative energy (anything other than fossil fuels).
Produce a slide presentation which answers these questions. You should have 10 slides, minimum. No more than 15 slides. Each slide should answer one of the following questions. Each slide should have a picture on it. Avoid lengthy texts on slides. Create an interesting presentation. Leave off a question if it does not pertain to your topic.
1. How is your resource used to generate power?
2. What is the history of your energy resource?
3. Where is it being used right now?
4. What are the positive benefits?
5. What are the negative consequences (pollution created)?
6. How efficient would this resource be (is it expensive to produce and does that carry over to the consumer)?
7. Is this energy source available in your community?
8. Is it available in your state?
9. What is the cost of this energy source? Daily, yearly? Individual? Home?
State? (ESTIMATE THESE NUMBERS IF NEEDED)
10. How is this source provided to consumers?
11. How does it enter the house? The schools? How does it work?
13. How would it affect transportation?
14. Does it contribute to any form of pollution? land? water? air? noise? or does
it help fix pollution?
15. Will it be easy to assimilate into our lives?
16. Can it work well with other forms of energy?
17. What is the source? What is the form? How does it interact with other forms
of energy?--------Example: sun--> solar energy--> solar panels--> electrical
energy

Answers

Answer:

1. How is your resource used to generate power?

Explanation:

Which is a likely response to this rising
demand?
O New distribution systems will be used to improve delivery of the wood to Cillian.
O The trees will be regulated to maintain the availability of the wood.
O New processes will be developed to locate the trees more efficiently.
O The wood will be used as quickly as possible while it is available.

Answers

Answer:

New processes will be developed to locate the trees more efficiently.

Plz help me its due soon. And no download link plzzzzzzzz

Cladograms are diagrams that can be used to show evolutionary relationships between different species. The diagram below is a cladogram of four plant groups.

According to the diagram, which pair of groups diverged most recently?

A. conifers and ferns

B. conifers and mosses

C. flowering plants and ferns

D. flowering plants and conifers

Answers

Answer:

D

Explanation:

it is at the highes point in the cladogram

Answer:

The answer is D. floweringplants and conifers

Explanation:

yerp

Are floating cities the solution to rising sea levels???
(HELP ASAPP!!!!!!!!!)
(resources for evidence please)

Answers

Answer: Floating Cities Aren't the Answer to Climate Change

UN-Habitat is looking at high-tech urban islands as a potential survival fix for communities at risk from rising seas.

Explanation:

Floating Cities Won't Save Us From Climate Change ...https://www.bloomberg.com › news › articles › floating-ci...

Which is required for both anaerobic respiration and aerobic respiration?

Answers

Answer:

Water, mitochondria, and glucose are all required for both anaerobic respiration and aerobic respiration.

Both anaerobic respiration and aerobic respiration require glucose as a source of energy as glucose is a molecule that is converted into energy in cells and that is used as a fuel source in both aerobic and anaerobic respiration.

What is the significance of the two types of respiration?

Aerobic respiration is a type that takes place in the presence of oxygen and forms energy and carbon dioxide and it is the most efficient type of cellular respiration, while on the other hand, anaerobic respiration takes place in the absence of oxygen and results in the production of energy and other metabolic byproducts, such as lactic acid or alcohol.

Hence, both anaerobic respiration and aerobic respiration require glucose as a source of energy as glucose is a molecule that is converted into energy in cells and that is used as a fuel source in both aerobic and anaerobic respiration.

Learn more about the respiration here.

https://brainly.com/question/18024346

#SPJ6

*Please Hurry!*
Which principle tells us that this area has undergone tilting?
a. original horizontality
b. cross-cutting
c. superposition
d. inclusions

Answers

Answer:

A.

Explanation:

original horizontality

Why may an asthmatic patient produce a wheezing sound and difficulty in breathing​

Answers

Answer:

Wheezing happens when the airways are tightened, blocked, or inflamed, making a person's breathing sound like whistling or squeaking. Common causes include a cold, asthma, allergies, or more serious conditions, such as chronic obstructive pulmonary disease (COPD).

Explanation:

What kind of physical property is being shown when You put water, food coloring, and oil together?

Answers

Answer:

Appearance or texture

Explanation:

This is because when food coloring is mixed with water and oil, the oil and water cannot mix but the oil firms droplets. When the coloring is also added it will not mix because of water and oil and immiscible. Therefore, the physical property will be appearance, it appearance will differ than before and also there will be a change in texture.

By the end of the Jurassic Period, the Sundance Sea was filled up with sediments and formed a swampy lowland known as

Morrison Foredeep
Panthalassa Moor
Franciscan Terrane
Great Black Swamp
Solenhofen Swamp

Answers

Answer:

Morrison Foredeep

Explanation:

Morrison Foredeep is a swampy lowland formed due to filling of Sundance Sea  with sediments during Jurassic period. Series of sedimentary rocks deposited during the Jurassic Period in the western North America, from Montana to New Mexico. Morrison Formation is famous for the presence of  dinosaur fossils, which have been collected since 1877 about more than a century ago beginning with a find near the town of Morrison, Colorado.

Which process of respiration does fermentation utilize?

Answers

Answer:

anaerobic respiration: A form of respiration using electron acceptors other than oxygen. fermentation: An anaerobic biochemical reaction. When this reaction occurs in yeast, enzymes catalyze the conversion of sugars to alcohol or acetic acid with the evolution of carbon dioxide

Explanation:

Are floating cities the salutation to rising sea levels

Answers

Explanation: no sunken cities are

Solve: Suppose an mRNA strand in the cytoplasm has 15
nucleotides. How many amino acids would be in the resulting
protein chain? Explain how you got this number. NO LINKS NO LINKS !!!

Answers

Answer:

(Sorry messed up the first time and didnt put an explanation) Four

Explanation:

It is four because there are three nucleotides in a set to make an amino acid. This would make 15 divided by 3, which is 5, but the last one is the code for stop (that is, to tell when a new chain for protiens should start), and that doesn't count as an amino acid.

What process involves rainwater filtering through soil?

Answers

I believe it’s called perculation

What happens if you place all four zip bags of apples in a dark for a week. What would be the observation for all four apples…

Answers

Answer:

They would slowly decomposeanf then become mushy.and nasty

What makes Kingdom Protista unique compared to the other kingdoms?

Answers

Protists are eukaryotes, which means their cells have a nucleus and other membrane-bound organelles. Most, but not all, protists are single-celled.

Biotic factors are the _____things in an environment? Multicellular, Eukaryotic, living or used to be living, Non living

Answers

Answer:

living

Explanation:

Biotic factors are the living parts of an ecosystem. Because of the way ecosystems work – as complex systems of competition and cooperation, where the action of every life form can effect all the others – any living thing within an ecosystem can be considered a biotic factor. Biotic factors such as soil bacteria, plant life, top predators, and polluters can all profoundly shape which organisms can live in an ecosystems and what survival strategies they use. Eukaryotic unicellular living beings Living beings that are made up of one single eukaryotic

Mendel was a careful researcher who studied the inheritance of certain traits in garden peas. What are some of the research practices Mendel used? Choose all that apply.
A. He crossed true-breeding pea plants.
B. He allowed eggs to be fertilized only by self-pollination.
C. He analyzed his data mathematically.
D. He controlled variables by studying one or two traits at a time.

Answers

D. He controlled variables by studying one or two traits at a time
Other Questions
Quanto 100cm em metros? since multiplication is implied algebra we often dont need to actually write thetimes symbol . Re-write this algebraicequation without the times symbol.a b = 4 c 10. A tractor costs $13,650 and depreciates in value by 14% per year. How much will the tractor be worth after10 years?a $2,597.86 b. $13,510.00 c. $3,020.77 d. $50,603.57 7th grade math Write the partial fraction decomposition of the rational expression:(3x-5)/(x^2 - 6X - 16) Find the slope and y-intercept from the following graph of a linear equation. What genes give cell the instructionsof what to differentiate into?A. master control genesB. enzyme genesC. RNA Complete the sentence with the correct comparative or superlative adjective. A study has found that the surface of Titan, Saturn's moon, is____ (rigid)previously thought. if u know anything about force and acceleration please help lol I didn't pay attention to this on 8th grade (no links pls) Help with 2 3 4 and 5 please! The question is in the pic please helppppp A chef at a restaurant uses 19 pounds of butter each day. About how many grams of butter does the chef use each day? use the conversion factors 16 ounces/1pound and 28.4 grams/1 ounce 2) Choose the best answer.An organelle where amino acids are joined to make proteins is a ___________.A. cytoskeletonB. lysosomeC. mitochondriaD. vacuoleE. ribosome3) Choose the best answer.The ________ provides structure and support to the cell.A. vacuoleB. cytoplasmC. cytoskeletonD. lysosomeE. mitochondria4) Choose the best answer.An organelle which is involved in photosynthesis is the _________.A. chloroplastB. vacuoleC. cytoskeletonD. ribosomeE. lysosome 1. The predator is the organism that does th____ And eating? How Did The Compromise Of 1850 Deal With The Admission Of California To The Union? What historical event influencedpeopleof the Renaissance to view their livesless controlled by fate and moreopento opportunity?A. The outbreak of the plague In Europe decreasedpeople's belief that Ilfe was controlled by fate.B. Albert Einstein's discoveries in physics helpedpeople of the Renaissance seek for new opportunity.C. The invention of the printing press madeInformation and new opportunity available to themasses, please help i am giving brainilest for the best answerE Complete with the correct preterite form of the indicated verb(s).1516. Yo lo ________ ayer y le _______ el libro. (ver, dar)1718. Yo _________ anoche, pero ellos _______. (salir, salir)1920. T _______________ y l te ___________________. (escribir, escribir)2122. Ustedes ________ pero nosotros no lo ________. (comprender, comprender)2324. T ______________ el bus, pero nosotros no lo ___________. (perder, perder)2526. Yo lo _____________ pero l lo _____________. (or, leer)27. Ellos _________ la msica ayer. (oir)no dam links If you put a link i will hack your brainliy account what is ur favorite anime mine is attack on titanhello there good people here is 50 points for free have a good day What's the difference between a Flyer and a Pamphlet? please help!!!No links