drag each label to the correct image identify the types of reproduction represented in the images

Drag Each Label To The Correct Image Identify The Types Of Reproduction Represented In The Images

Answers

Answer 1
Tough one would have been expressing another way?

Related Questions

PLEASE help its a question about rocks I'm tryna score a 80

Answers

Answer: The answer is C

Explanation:

lavas cool quickly at the earth's surface and are characterized by fine-grained texture, in which the crystals are too small to be seen by the unaided eye. Very quickly cooled lavas, typically those quenched in water, will have a glassy texture. They cool too quickly to form crystals.

6. Name the nitrogenous wastes excreted by the following organisms:-
(1) Desert mole
(ii) Marine fish
(111) Tilapia​

Answers

Answer:

Desert mole excretes concentrated urine with urea.

Marine fish excretes urine with uric acid.

Tilapia excretes dilute urine with amino acids.

Explanation:

The nitrogenous wastes that are excreted by the following organisms are as follows:

Desert mole: Urea.Marine fish: Uric acid.Tilapia: Amino acids.

What is Nitrogenous waste?

Nitrogenous waste may be defined as the compounds which are excreted by the organisms that contain an excessive amount of nitrogen or its derivative products.

Among the above-given organisms, Desert mole and Marine fish are Ureotelic organisms that excrete either concentrated or diluted urine with a significant amount of urea and uric acid respectively.

While Tilapia is an Ammonotelic organism that excretes diluted urine with a significant amount of amino acids.

Therefore, it is well described above.

To learn more about Nitrogenous waste, refer to the link:

https://brainly.com/question/9517408

#SPJ2

Which is an example of the use of plants in human societs?

Answers

Answer:

|

v

Explanation:

photosynthesis creates oxygen, water and glocose(starch) and we take in those and use it in our mitochondrias to create atp so it can hapen all over again.

Human uses of plants include both practical uses, such as for food, clothing, and medicine, and symbolic uses, such as in art, mythology and literature.

Which of the following solutions would have solute concentration that is lower than the concentration found inside the cell

Answers

Answer:

hypotonic solution

A hypotonic solution has a lower solute concentration than inside the cell (the prefix hypo is Latin for under or below). The difference in concentration between the compartments causes water to enter the cell.

Thank you and please rate me as brainliest as it will help me to level up

Answer:

A. Hypotonic Solution

Three samples of cells from three different patients were unlabelled. One sample was from an 85-year-old man, one was from a 5-year-old boy, and one was from a person with skin cancer. How could you determine to which patient they belonged?

Answers

The 85 year old man will have shorter telomeres.

The 5 year old will have long telomeres.

The person with skin cancer will have an abnormal karyotype and abnormal nucleus shape and size during interphase.

4
_ is a component of soil made entirely of decomposed organic remains. This component increases soil fertility and _
the ability of soil to retain water.
A. Humus; increases
B.
Parent material; decreases
C.
Subsoil; increases
D
Topsoil; decreases

Answers

Answer:

The answer is A

Explanation:

am 100% sure

What is the definition of cell

Answers

Answer:

Small and sparsely furnished room, especially in a prison or convent.

"the detainees are together in cells with capacity for four or five people"

Cell of a honeycomb.

Explanation:

I hope to help you

The definition of a cell: The basic membrane-bound unit that contains the fundamental molecules of life and of which all living things are composed.

Which describes something that occurs during translation?

Answers

Answer: In translation process, the messenger RNA (mRNA) template is used to create amino acid chain by which a protein is formed. Translation is the process of synthesis of proteins from amino acids which the help of mRNA

Answer:

c

Explanation:

Which is a term for a type of detritivore?
Carnivore
Decomposer
Herbivore
Omnivore

Answers

Answer:

Decomposer

Explanation:

Decomposers eat dead organsims carnivores rarely

Answer:

C. Decomposer

Explanation:

A.P.E.X

Can a
Brain cell
Fat cell
Muscle cell
Red blood cell
Liver cell
Convert one type of fuel molecule to another

Answers

answer: yes

exanation:

describe and explain how the rate of photosynthesis is affected by light intensity​

Answers

Increasing the light intensity increases the rate of photosynthesis, until some other factor - a limiting factor - becomes in short supply. At very high light intensities, photosynthesis is slowed and then inhibited, but these light intensities do not occur in nature.

I could really use some help on this question l, please help!?! Thank you ❤️ much love stay safe 2020

Answers

Answer: its B and D

Explanation:

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Answers

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

what dose cloraplast do​

Answers

n particular, organelles called chloroplasts allow plants to capture the energy of the Sun in energy-rich molecules; cell walls allow plants to have rigid structures as varied as wood trunks and supple leaves; and vacuoles allow plant cells to change size.

Answer:

Chloroplasts are a plant cell organelles and help. plants capture the energy of the sun.

Explanation:

they convert light energy to the sun relatively stable chemical energy via the photosynthetic process. By doing so, they sustain life on Earth

Summarize the possible applications of gene knockout GMOs.

Answers

Answer:

This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. ... This method then relies on the cell's own repair mechanisms to recombine the DNA construct into the existing DNA.

Explanation:

This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. ... This method then relies on the cell's own repair mechanisms to recombine the DNA construct into the existing DNA.

Describe how the circulatory system allows the endocrine system to do its job?​

Answers

Answer:

The circulatory system is the transport system for endocrine info. The endocrine chemicals and hormones must circulate through the body via blood vessels.

what is a cell membrane?

Answers

Answer:

The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm.

Explanation:

Answer:

Short. The semipermeable membrane surrounding the cytoplasm of a cell.

Long. The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm. The cell membrane separates the cell from the surrounding interstitial fluid, the main component of the extracellular fluid.

Explanation:

Hemoglobin is:
1) hormone;
2) Enzyme
3) protein;
4) Amino acid


HELPPP PLEASE!!!!

Answers

Answer:

The oxygen- carrying pigment and predominant protein in the RBC.

Which of these are true of physical therapists? Check all of the boxes that apply.

All physical therapists can diagnose.

Physical therapists strengthen muscle and improve balance.

Physical therapists do not prescribe medication.

Physical therapists are considered doctors.

Physical therapists are commonly called physiatrists.

Answers

2nd, and the last one

Genetic engineering involves _______ to achieve desired results. a. enzyme production b. modifying products and processes c. changing one organism into another d. introducing traits into organisms Please select the best answer from the choices provided A B C D

Answers

Answer:

D

Explanation:

the answer is d bruv like fr

Answer:

D

Explanation:

DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD

What three things regarding cell organelles are different between plant and animal cells?

Answers

Answer:

Plant cells have a cell wall, but animals cells do not. ...

Plant cells have chloroplasts, but animal cells do not. ...

Plant cells usually have one or more large vacuole(s), while animal cells have smaller vacuoles, if any are present

1. what is an organelle?

2. give me an example of an organelle.

3. Which organelle is the "command center" of
the center?

Answers

Answer:

1. a subcellular structure that has a job to do within the cell

2. mitochondria

3. the nucleus

What are common changes
In an environment?

Answers

Answer:shelter, land, prey

Explanation:

Changes? Do you mean like temperature and humidity

I'll give you a brainliest if is right or at least shows some effort
(thanks & i hope your having a good day)

In your own words, explain how background noise detected in space provides evidence for the Big Bang Theory.

Answers

Answer:

Celestial microwave radiation found a strange microwave signal causing background noise in the radio telescope. The signal came from every direction. The young universe would have been very hot. The microwave background radiation is the remaining heat from the Big bang.

I tried my hardest and this is what I put on MY test so good luck

Which of the following IS NOT a part of the cell theory? *
All organisms are made of one or more cells
All cells contain nuclei and membrane bound organelles
Cells arise from pre-existing cells
Cells are the basic units of structure and function

Answers

Answer:

all cells contain nuclei.

Explanation:

prokaryotes dont have a nuclei

plants Which part of the carbon cycle occurs when plants, trees, or fossil fuels are burned?
A. Transpiration B. Oxidation C. Photosynthesis D. Combustion

Answers

I believe C- photosynthesis but I could be wrong.

A student observes that a plant has droopy leaves and stems and infers that the rate of photosynthesis has slowed in the plant. Which statement provides evidence to support the student’s inference?

Answers

Answer:

A. The water pressure in the plant's vacuole is low, and without water, the chloroplasts cannot convert carbon dioxide to glucose during photosynthesis.

Explanation:

Photosynthesis occurs on chloroplasts which are located on the surface of leaves. Photosynthesis is the conversion of carbon dioxide, water, and light energy to produce glucose and oxygen for plants.

The vacuoles inside the plant's cell contain stored food and absorb water through osmosis. Water in the vacuole has more solutes than water outside the vacuole. This causes the Turgor Pressure which the vacuole impacts on the plants. If the reverse becomes the case, water is lost from the vacuole causing it to shrink.

Flaccidity of the vacuole and the cell wall will cause the chloroplasts where photosynthesis occurs to shrink.

What are two ways in which cells use the energy temporarily stored in ATP?

Answers

Answer: Energy provided by ATP is used in active transport, to contract muscles, to make proteins, and in many other ways

The two main ways in which cells use the energy temporarily stored in the form of ATP is in active transport, and to make proteins.

What is Active transport?

Active transport is the movement of molecules, ions, solutes, solvents against the concentration gradient. The flow of material takes place from the region of their lower concentration to the region of their higher concentration. The transport is against the gradient and hence requires energy to proceed which is given by ATP.

ATP is required to synthesize proteins in the ribosomes of the cell through the process of translation. This is a highly energy-consuming energy and thus required large amount of ATP.

Learn more about ATP here:

https://brainly.com/question/14637256

#SPJ2

1. Peer review allows others in the field to assess a scientist's investigations and results.
a. True
b. False

Answers

Answer:

False.

Explanation:

Peer review provide others scientist in the field to assess a scientist's investigations and results.

Peer Review:

It is the reviewing or evolution of the work by many professionals and experts in the field.

For example-  A scienfic manuscript is send to the many scientist for evolution before publication.

This peer review is unbiased because the reviewer does not know the name or other information about writter.

To know more about  Peer Review:

https://brainly.com/question/10853815

The movement of water in or out of the cell membrane without the use of ATP.

Diffusion

Facilitated diffusion

Osmosis

Excoytosis

Answers

The answer is Osmosis because its the only one that has anything to do with water
Other Questions
Help please help help The last line in a business letter is the _______.Help please 30 POINTS HELP ME ASAP How did Spain originally respond to conflict with the United States over the use of the Mississippi River? Spain wanted to close the river to American traders.Spain declared war on the United States. Spain signed over the river rights to the United States. Spain tried to transfer the river rights to France in secret. Diana hangs a lead cylinder with a force of 12 N from a model bridge.Which vector(s) accurately illustrates the reaction force of the bridge on the lead cylinder? How does geotheHow does geothermal energy differ from solar energy? Geothermal energy is cooler and denser than solar energy. Geothermal energy comes from the internal heat of Earth. Geothermal energy is transmitted through the atmosphere. Geothermal energy results from radiation of electromagnetic waves.rmal energy differ from solar energy? Determine the intercepts of the line.x-intercept:y-intercept: Please answer this correctly without making mistakes it's a social Studies question(practice) Insert the missing code in the following code fragment. This fragment is intended to implement a method to set the value stored in an instance variable. Public class Employee { Private String empID; Private boolean hourly; ) . . _______ { Hourly = isHourly; } } A) public void setHourly(String isHourly) B) public void getHourly() C) public boolean getHourly() D) public boolean setHourly(boolean isHourly) 3.0625 divided by 7 in long division Simple Interest ProblemSuppose 30=a60.What is 30/a In the two step cellular process of transcription and translation(A) chromosomes line up and then are pulled to opposite ends of the cell.(B) stem cells develop in embryonic cells, which then form adult tissue cells.(C) the DNA double helix is separated and then replicated to form two strands of DNA.(D) a DNA sequence is copied to form an RNA sequence, and then copied to form a protein. Which is common to both photosynthesis and respiration?es)ANADH is produced by Krebs cycleB)Chemical energy is produced in the. form of ATPTwo ATP are formed by the process of glycolysisD)Glyceraldehyde-3 phosphate is produced by Calvin cycle,Matter and EnerHot Point T is at (-3, 8). What are the coordinates of T' after R(y-axis) o R(x-axis)? A librarian has 883 books to place on shelves. Each shelf holds 98 books. How many books will be left over after filling as many shelves as possible? Point k lies at (-3,4). Point k is reflected over the y-axis and then translated 7units down to produce K'. Which rule could have been used to produce K' from K?K(x, y) +K'(x,y-7)K(x,y) K'(-x, y-7)K(x,y) K'(x, -y-7)K(x,y) K'(-x-7.-y-7) Divide 4 1/4 by 2. A gallon of Moo Milk costs \$5.12. What is the price, in dollars, of an 8-ounce glass of Moo Milk?There are 128 ounces in 1 gallon. I DONT GET THIS QUESTION SOMEONE PLEASE HELP **EMERGENCY IN TEST RN** How did the offspring end up with traits that are different from the traits of their parents?