Determine the mRNA and amino acid sequence for the below DNA sequence.

Determine The MRNA And Amino Acid Sequence For The Below DNA Sequence.

Answers

Answer 1
AUGAGCCCCGCUAGGUUCUC

Related Questions

Which of these organic molecules function to help speed up biological reactions?

Answers

Answer:

c

Explanation:

The real length of one villus is 0.8 mm
Calculate the image length if the villus is viewed at a magnification of x20

magnification = size of image / size of real object

Answers

Answer:

Explanation:

Re arrange formula=Size of image=Magnification*size of real image

0.8mm*20=16mm

The image length will be "16 mm". A further explanation is below.

Given:

Magnification,

20

Size of real image,

0.8 mm

As we know the formula,

→ [tex]Magnification = \frac{Size \ of \ image}{Size \ of \ real \ image}[/tex]

or,

→ [tex]Size \ of \ image=Magnification\times Size \ of \ real\ image[/tex]

By substituting the values, we get

→                         [tex]=20\times 0.88[/tex]

→                         [tex]= 16 \ mm[/tex]  

Thus the response above is correct.

Learn more:

https://brainly.com/question/24716995

Which of the following statements is true about niches?
I. New species can outcompete native species to fill a niche.
II. Extinction or emigration of a species can leave a niche vacant.
III. Some species occupy niches that no other species can fill.

Answers

Answer:

0

Explanation:

Explain how organisms in both of the ecosystems are dependent on their environmental interactions with other living things and with nonliving factors.

Answers

Answer:

Explanation:Organisms, and populations of organisms, are dependent on their environmental interactions both with other living things and with nonliving factors. ... Mutually beneficial interactions, in contrast, may become so interdependent that each organism requires the other for survival.

The organism that considered for an ecosystem that should be dependent on the environmental interactions should be explained below,

Environmental interactions:

The organism and the organism population should be based on the environmental interactions along with the other living things also even with the non-living things of factors.

On the other hand, Mutually beneficial interactions should be considered as the independent where each and every organism should needed other for the survival purpose.

learn more about an organism here: https://brainly.com/question/18167856

PLSSSSSSS HELPPPPPPP I WILL GIVE BRAINLIESTTTTTTTTTT!!!!!!!!!!!!!!!!!!!!!PLSSSSSSS HELPPPPPPP I WILL GIVE BRAINLIESTTTTTTTTTT!!!!!!!!!!!!!!!!!!!!!PLSSSSSSS HELPPPPPPP I WILL GIVE BRAINLIESTTTTTTTTTT!!!!!!!!!!!!!!!!!!!!!PLSSSSSSS HELPPPPPPP I WILL GIVE BRAINLIESTTTTTTTTTT!!!!!!!!!!!!!!!!!!!!!PLSSSSSSS HELPPPPPPP I WILL GIVE BRAINLIESTTTTTTTTTT!!!!!!!!!!!!!!!!!!!!!PLSSSSSSS HELPPPPPPP I WILL GIVE BRAINLIESTTTTTTTTTT!!!!!!!!!!!!!!!!!!

ALL MATTER HAS THE SAME PROPERTIES.
A. True
B. False

Answers

Answer:

false

Explanation:

some don't

Answer:

FALSE

gases and solids and liquids all have very different properties, thats not even mentioning plasma and BEC

Explanation:

thanks for the opportnity sir

Explain in a paragraph how speed and velocity impact blood splatter


Please no links!

Answers

Answer:

The force of the blood hitting a surface for medium velocity blood spatter is between 5 and 100 feet per second. This causes the droplets of blood to be smaller in diameter, and more like a spray. High velocity blood spatter: ... This causes the pattern of the blood to be similar to a fine spray.

Explanation:

Neuromodulation is the release of chemicals (other than ____________ ) from cells that locally regulate or alter the response of neurons to neurotransmitters. The substances released are called ____________ . Neuromodulation generally results in either facilitation or inhibition. When there is greater response from a postsynaptic neuron because of the release of neuromodulators it is ____________ . This may result from either ____________ amount of neurotransmitter in the synaptic cleft or ____________ number of receptors on postsynaptic neurons. When there is less response from a postsynaptic neuron because of the release of neuromodulators, it is called ____________ . This results from either ____________ amount of neurotransmitter in the synaptic cleft or ____________ number of receptors on postsynaptic neurons.

Answers

Answer:

Neurotransmitters; neuromodulators; facilitation; an increased; an increased; inhibition; a decreased; a decreased.

Explanation:

In Biology, stimulus can be defined as an obvious change in either the chemical or physical structure of an organism' environment (either external or internal). Thus, all living organisms (both animals and plants) respond to changes in their environment and consequently, an appropriate response or reaction is made. Also, stimulus arising from within the organism is known as internal stimulus while those from its environment are known as the external stimulus.

In organisms, the specialized cells that detect stimulus are generally known as sensory receptors while a group of these receptors is referred to as sense organ.

Neuromodulation is the release of chemicals (other than neurotransmitters ) from cells that locally regulate or alter the response of neurons to neurotransmitters. The substances released are called neuromodulators. Neuromodulation generally results in either facilitation or inhibition. When there is greater response from a postsynaptic neuron because of the release of neuromodulators it is facilitation. This may result from either an increased amount of neurotransmitter in the synaptic cleft or an increased number of receptors on postsynaptic neurons. When there is less response from a postsynaptic neuron because of the release of neuromodulators, it is called inhibition. This results from either a decreased amount of neurotransmitter in the synaptic cleft or a decreased number of receptors on postsynaptic neurons.

Over 400 years ago, the bark of the cinchona tree was discovered to contain a chemical compound called quinine. Quinine was, and still is, used to cure and prevent malaria. This is an early example of ____________________.

a. biotechnology

b. scientific modeling

c. genetic engineering

d. genomics

Answers

Answer:

A.

Explanation:

How many sugar phospha te backbones are in one strand of DNA?

Answers

Answer: Two

Explanation: In double-stranded DNA, the molecular double-helix shape is formed by two linear sugar-phosphate backbones that run opposite each other and twist together in a helical shape. The sugar-phosphate backbone is negatively charged and hydrophilic, which allows the DNA backbone to form bonds with water.

Inside a human stomach, hydrochloric acid is important in digestion. Which reason best explains why the enzymes found in other parts
of the body would not function well in the stomach?
a. The temperature is too high
b. There is not enough water
C. The pH is too acidic
d. There are not enough substrates

Answers

Answer:

C. The pH is too acidic

Explanation:

Many acids and bases in living things are secreted to provide the proper pH for enzymes to work properly. Enzymes are biological catalysts, such as pepsin, which is needed to digest protein in the stomach and requires an acidic environment.

DNA double helix. Hydrogen bonds break and helix opens. Each strand of DNA acts as a template for synthesis of a new, complementary strand. Replication produces two identical DNA double helices, each with one new and one old strand.

Answers

Answer:

The process described above is known as DNA replication.

Hope this helps you! Have an amazing day!

An organism with a mutated cell

Answers

Answer:.

An organism with a mutated cell is mutant

Hope this helps!

A complex multicellular organism has different levels of organization. What is the order of the levels from least complex to most complex?

1organ system, organ, tissue, cell
2cell, tissue, organ, organ system
3cell, organ system, organ, tissue
4organ, tissue, cell, organ system

Answers

Answer:

A. tissue, cell, organ, organ system, organism

Explanation:

The order of the levels from least complex to most complex are 3cell, organ system, organ, tissue.

What is complex multicellular?

The term multicellular organism is known to be a type of an organism that is made up of multiple cell.

These organisms are known to be complex due to the fact that they have different kinds of differentiated cells such as 3cell, organ system, organ, tissue.

Learn more about multicellular organism  from

https://brainly.com/question/11801282

The image represents the mitosis process and it is important because:

A. produces gametes with half genetic information than parent cell.
B. allows processes as growing and repair tissues in the body.
C. does not produce cells with the same genetic information than parent cell.
D. always produce somatic cells with the same characteristics, it does not matter the organ in the body.

Answers

Answer:

B. allows processes as growing and repair tissues in the body.

Explanation:

Mitosis is a process where a single cell divides into two identical daughter cells. During mitosis one cell divides once to form two identical cells and the dividing cell's chromosomes are copied and then distributed equally between the two new nuclei of the daughter cells.

The major purpose of mitosis is for growth and to replace worn out cells. It also plays an important part in the development of embryos.

Mitosis is divided into five stages:

1. Interphase- during interphase, the DNA in the cell is copied resulting in two identical sets of chromosomes. Microtubules also extend from the centrosomes outside the nucleus

2. Prophase- during this phase, the sister chromatids in each chromosome pair up, the nuclear membrane dissolves and the mitotic spindle consisting of microtubules and other proteins extend across the cell between the centrioles which move to opposite ends of the cell.

3. Metaphase- the chromosomes line up at the centre of the cell and the mitotix spindle attaches to eachmof the sister c hromatids.

4. Anaphase- the sister chtomatids are pulled apart to each end of the cell by the mitotic spindle.

5. Telophase- at each pole, a full set of chromosomes gather together, a membrane encloses each chromosome, the cell pinches at the middle and then divides into two. This is known as cytokinesis.

Summarize the path of an oxygen molecule from the nose to the bloodstream the​

Answers

Answer:

The oxygen molecule passes through the wall of the alveoli and enters inside tiny blood vessels called capillaries where exchange occurs.  A protein called hemoglobin in the red blood cells then carries the oxygen around your body.

Explanation:

Which of the following BEST describes the primary goal for meiosis:

Answers

Answer:

D) Daughter cells are produced with only half the chromosomes of the parent cell.

Explanation:

The primary goal of meiosis is to create four gametes, which are cells with only half the chromosomes of the parent cell

What option would be a good adaptation for an animal in a dense RAINFOREST? *
A. heavy body
B. ability to sprint
C. ability to blend with multiple colors and patterns

Answers

Answer:

c because they need to live instead of dying. bc from other bigger animals they can see it and eventually die so.

Provide two reasons why it is important to isolate undigested plant cells.
I need this asap

Answers

Answer:

It helps to support growth and helps producing energy to do vital functions.

Hope this helps!

A reliable DNA analysis is based on the DNA conditions. The importance of using undigested cells is that DNA is well-preserved, not affected by external factors, and can be used to compare it to database sequences.

------------------------------------------

Dr. Pringle studies niche partitioning and competition reduction among coexistent species in Africa.

He is interested in knowing the exact source of food of different herbivorous species. To do so, he is using the technique of DNA metabarcoding.

He collects fresh animals' dung and gets the indigested plant cells.

DNA is isolated, sequenced, and compared with the DNI of known species, which are a potential source of food for these animals.

Once he matches the cells' DNA with the corresponding plant species from the database, he can use this information to detail the animal's source of food.

The importance of getting fresh, undigested cells from the dung, is that

The animal's digestive enzymes have not broken the cell walls and digested the cell content. The dung environmental conditions such as pH, temperature, or microbiota have not affected the cell's DNA. Undigested cells' DNA is well-preserved and can be used to compare it with the plant species database.

------------------------------------------------------

Related link: https://brainly.com/question/19670710?referrer=searchResults

                    https://brainly.com/question/15195300?referrer=searchResults

clearing of these has a harsh effect on animal population. What is it called?

Answers

Trees I’m guessing is the answer

4 A population of tree-climbing lizard lives on one bank of a large river.
The other bank of the
river is a treeless prairie. During a flood, 40
lizards were transferred to the prairie side
of the river. After 200
generations, this transferred population of lizard lost the ability to
climb.
Which mechanism is MOST likely responsible for this loss of function
within the transferred
population?
natural selection
genetic drift
gene flow
mutation

Answers

Answer:

Genetic Drift, it is a textbook example of genetic drift.

hope this helped <3

Compare cladistics with Linnaeus's classification

Answers

Cladistic is the arrangement of organisms according evolution, while in linear taxonomy, organisms are classified on the basis of similarities.

Describe Why are trochophores of interest to biologists?

Answers

Answer:

Because it is also one of the larval stages in some other groups of invertebrates, and are used by biologists to deduce evolutionary relationships among different groups of invertebrates

Explanation:

hope it will help you.

You leave a cracker in your mouth for 7 minutes without chewing. Hormones signal amylase to be released in your mouth and the cracker begins to dissolve. Which to systems ane being used in this scenario?
A.Endocrine & Immune
B.Digestive and Skeletal
C.Endocrine & Digestive
D.Digestive and Excretory​

Answers

{Answer}

D- digestive and excretory

{ I hope this helps homie :) }

Pls help me and thank youuuu

Answers

Is between B and C but the correct answer should be B
The answers should probably be B

distinguish between active and passive immunity​

Answers

Answer:While active immunity occurs when an individual produces antibodies to a disease through his or her own immune system, passive immunity is provided when a person is given antibodies.

Explanation:

state the taxonomic family to which the virus that causes EVD belongs​

Answers

Ebolavirus, genus of viruses in the family Filoviridae, certain members of which are particularly fatal in humans and nonhuman primates. In humans, ebolaviruses are responsible for Ebola virus disease (EVD), an illness characterized primarily by fever, rash, vomiting, diarrhea, and hemorrhaging.

3) identify and describe three abiotic characteristics of ecosystems. Give an example of how each

characteristic could be affected by a human activity

Answers

Answer:

The abiotic characteristics of an ecosystem that affects man includes: Land surface, rainfall and relative humidity.

Explanation:

In the ecosystem, man occupies the terrestrial habitat which is affected by the abiotic factors listed above.

Abiotic (non- living) factors determine the type of biotic (living) community that is found in an ecosystem. These factors include Land surface, rainfall and relative humidity, just to mention a few.

--> LAND SURFACE: This is responsible for the marked variation in the vegetation of a place. For example, a mountain in the tropics may have a rain forest vegetation at it's base and an afroalpine vegetation near its peak. The gradient of the slope affects the growth of organisms. A steep slope encourage fast run - off of water and therefore encourages erosion, which results in shallow and infertile soil. This in turn AFFECT man's farming activities as there would be little to no crop yield.

--> RAINFALL: Water is a very important abiotic factor that affects life. The main source of water to terrestrial habitat is rainfall. When rain falls, a greater percentage of it sinks into the soil while the rest run- off into water bodies. Water is absorbed by root hairs into the plant and used for photosynthesis to produce food. The absence of rainfall in the environment of man could lead to drought which AFFECTS man negatively.

--> RELATIVE HUMIDITY: This is a measure of the amount of moisture in the atmosphere. It's usually high in hot wet regions. It affects the rate at which water evaporates from the body surfaces of organisms. Low relative humidity cause more water (sweat) to evaporate from body surfaces giving the human body a cooling effect. But in high relative humidity, the sweat cannot evaporate leaving the body feeling hot and sticky. This AFFECTS man as the body tries to cool off in a harder way by increasing rate of respiration and depth of blood circulation.

I Will Mark Brainliest

Which of the following is the broadest taxonomic category?
A
phylum
B
class
C
genus
D
domain

Answers

Answer:

I think it's A- phylum, hope this helps

The broadest taxonomic category is Domain

Which best describes how to classify water?
A It is an element because it is made
from a pure substance.
В
It is a compound because it is made
of a single kind of molecule.
© It is a mixture because it is composed
of more than one molecule.
D It is a solution because it is a
homogenous mixture of different
compounds.

Answers

Answer:

D

Explanation:

Water is a compound and scientifically known as H[tex]_{2}[/tex]0 (2 hydrogen atoms and 1 oxygen). Therefore, the answer is...

Not A because water is not an element of one pure substance; rather, it is a compound and can be broken down into two pure substances.Not B because the statement contradicts itself: a compound is made of different atoms and, thus, different molecules.Not C because a mixture contains different substances that are physically -- not chemically -- combined. And as we know, water is a compound, which means that its atoms are chemically bonded to one another. Or else it would just be 2 free hydrogen atoms and 1 oxygen.D (yay!) because it is not the *most* accurate, but simply the best description of those provided. Water can be described as a homogenous (uniform in appearance) mixture because, minus the "mixture" part, that's what it is, essentially: a substance that looks pure but is really made of up different molecules.

Ngl this was tricky, but I hope this helps :)

Match the following terms with the correct definition. Arterioles Arteries Capillaries Venules Veins Small vessels that carry blood away from the heart to the capillaries are __________. Muscular-walled vessels that carry blood away from the heart are _______. One-cell-thick microscopic vessels that function to exchange nutrients and wastes are _________. Small vessels that connect to the capillaries that carry blood back to the heart are ________. Vessels that carry blood back to the heart are _________.

Answers

Answer:

Small vessels that carry blood away from the heart to the capillaries are Arterioles. Muscular-walled vessels that carry blood away from the heart are Arteries. One-cell-thick microscopic vessels that function to exchange nutrients and wastes are Capillaries. Small vessels that connect to the capillaries that carry blood back to the heart are Venules. Vessels that carry blood back to the heart are Veins.

Explanation:

We have different types of vessels in our bodies. We can divide them by their size and structure. Starting from the ones that carry blood away from the heath, we have the arteries. Arteries are vessels of big diameter that have muscle around them. Then, the arteries branch into arterioles, which have a smaller diameter. The arterioles branch into capillaries. These are small vessels with thin walls that allow the exchange of nutrients, wastes, and gases with the neighboring tissues. Once that the blood flows through the capillaries, it goes to the venules, which are small veins that will carry the blood to the veins and these to the heart. The veins do not have muscles in their structures, and their walls are thinner than the ones in the arteries.

Other Questions
PLEASE ANSWER ASAP DUE IN 2 MIN WILL GIVE BRAINLEST!!!!!!!!!!!!!!!!PLEASE ONLY ANSWER PART B What is the volume 9inches 3inches 5inches Frases de al menos 8 palabras que no tengan las letras A T P N POR FAVOR 5 points5. Which of the following correctly identifies the piece of land that Egyptregained as part of the Camp David Accords? *The West BankThe Sinai PeninsulaThe Golan HeightsThe Gaza Strip Please I need help. The Median of a data set is 100. Which statement about the data set must be true?A. The data set has an average of 100B. Half the data values are greater than 100. C. The minimum value is 80 and the maximum value is 120D. Only one of the data points in the data set has a value of 100 Is rolling a 5 on a traditional number cube1. Impossible 2. Unlikely3. Likely4. Certain Chavez S.A., a Venezuelan company, wishes to borrow $8,000,000 for eight weeks (maturity). A rate of 6.250% per year is quoted by potential lenders in Great Britain, and Switzerland. British, and the Swiss-Euro bond definitions of interest (day count conventions) are 56 days and 60 days, respectively. Numbers of days in a financial year are 360. From which source should Chavez borrow? What type of eclipse will cast a larger shadow "Hold your horses and let me explain first" is an example of... idiom simile hyperbole personifcation Why was La Fonda, a Harvey House Santa Fe significant? John invests $15,000 in a savings account that pays 2.5% simple interest. If John makes nowithdrawals or deposits into the account, how much will be in the account after 9 years? 1 What did Mengele join in 1937?2 What war crimes was Josef Mengele accused of?3How did Josef support the Nazis?4 What nickname did he acquire?5 What role did he have with Auschwitz selections?6 What did he focus his medical research on?7 Mengele managed to escape Allied justice after the war and fled to South America. He died in 1979 in Brazil while swimming in the ocean. What was the cause of his death? What war crimes was Josef Mengele accused of? 2. According to the cartoonist, what was Americas most effective weapon in the Cold War> i neeeeeedddddd helppppppppppppppppppppppppppppp ppl How is this passage point of view Name the marked angle in 2 different ways.VUST Jonathan was granted enough nonqualified stock options (NQSOs) to purchase 10,000 shares of Capital, Inc. stock at $10 per share two years ago. He exercised the options this year when Capital, Inc. stock was $25 per share. Three years later, Jonathan sells the 10,000 shares for $100 per share. Which of the following statements regarding the tax ramifications of Jonathan's transactions are CORRECT?Capital gains tax is due the year the options are granted to Jonathan.Jonathan's cost to exercise all of the NQSOs is $50,000.Jonathan will have a $750,000 capital gain when he sells the stock at $100 per share.Jonathan will have an additional $150,000 included in his W-2 compensation income, which is a type of ordinary income, subject to payroll taxes this year.A) I, II, and IIIB) III and IVC) I and IID) I, II, III, and IV Based on the expression of what is supposed to be the parting cry of mothers in Sparta to their sons, what is considered important to them?"Come back with your shield - or on it." A. Education B. Family C. Fighting D. Colonizing A mint milk shake contains 1.25 fluid ounces of milk for every 4 ounces of ice cream. A strawberry milk shake contains 1.75 fluid ounces of milk for every 5 ounces of ice cream. Which milk shake is thicker? 7. Explain why the U.S. Fish and Wildlife Service decided to try to bring wolves back to theU.S.in the 1990s. Use text evidence to support your answer.Your answerOThis is a required question