Delia is teaching her sister about important molecules in the body.
She tells her sister that one molecule provides a set of instructions that determines traits, such as eyecolor or hair color. Which molecule is Delia describing?
Pls help !!

Delia Is Teaching Her Sister About Important Molecules In The Body. She Tells Her Sister That One Molecule

Answers

Answer 1

Answer:

answer is A

Explanation:


Related Questions

I NEED HELP ITS DUE RIGHT NOW PLEASE ( biology question !!! )

Answers

Answer:

A is the correct answer.

Where will you find permafrost? tall grass prairie savanna chaparral tundra

Answers

Answer:

Where Is Permafrost Found? About a quarter of the entire northern hemisphere is permafrost, where the ground is frozen year-round. It's widespread in the Arctic regions of Siberia, Canada, Greenland, and Alaska—where nearly 85 percent of the state sits atop a layer of permafrost.

Explanation:

hope this helps

Which of the following is an example of a negative tropism?

A. stems and leaves growing upward
B. leaves curling when touched
C. roots growing downward
D. leaves turning toward the light

Please help ASAP

Answers

Answer: B because leaves curling when touched is a negative tropism

Explanation:

Describe a DNA molecule and its shape

Answers

Answer:

DNA is a long molecule, made up of two strands twisted together to make a spiral known as a double helix.

The DNA molecule is shaped like a ladder that is twisted into a coiled configuration called a double helix. The nitrogen bases form the rungs of the ladder and are arranged in pairs, which are connected to each other by chemical bonds.

True Or False urgebt

Answers

Answer:

The answer is true

Explanation:

true

What is the relationship between a protein, the cell, and DNA?
A. DNA is produced by a protein which is produced in the cell
B. Protein is composed of DNA which is produced in the cell
C. A cell is composed of DNA and protein
D. DNA controls the production of protein in the cell

Answers

Answer:

B. Protein is composed of DNA which is produced in the cell

Explanation:

Answer:

B. Protein is composed of DNA which is produced in the cell

Explanation:

The option (B) is the relationship between a protein, the cell, and DNA.

What causes the "plastic" nature of
the asthenosphere?
A. it is mostly water
B. it only found under the ocean
C. constant earthquake activity
D. heat from below

Answers

The heat from below causes the "plastic" nature of the asthenosphere. The correct option is D.

What is asthenosphere?

The asthenosphere is the upper mantle's mechanically sluggish and ductile region.

It is located beneath the lithosphere, somewhere around 80 and 200 kilometers underneath the surface, and can extend up to 700 kilometers. However, the asthenosphere's lower boundary is not well defined.

Semi-plastic rock makes up the Asthenosphere. Because of Lithosphere has a lower density, it resides on top of the Asthenosphere, much like an iceberg or a block of wood does on water.

The lower mantle beneath the Asthenosphere is stiffer and less plastic. The outer core is located beneath the Mantle.

The "plastic" essence of the asthenosphere is caused by heat from below.

Thus, the correct option is D.

For more details regarding asthenosphere, visit:

https://brainly.com/question/7152935

#SPJ2

Use the following questions to write your conclusion to your lab report.

What did you learn from doing this lab? (Did the volcano have an effect on the ability of a predator to catch their prey? What might this mean for future generations? Include numbers from your data tables to show these changes.)



How could you make the lab better?

Answers

Answer:

WHat??

Explanation:

Will give brainliest

Jennifer is trying to determine the blood type of her parents for biology class. She knows that her blood type is B.

After asking her mother, she finds out that her mother's blood type is A. However, her father cannot remember his blood type.

Which of the following blood types could her father have?

I. A
II. B
III. AB
IV. O
A.
I or III only
B.
I, II, or IV only
C.
I, II, III, or IV
D.
II or III only

Answers

Answer:

C. I, II, III, or IV

Explanation:

I got it right on study island

Jennifer is trying to determine the blood type of her parents for biology class. She knows that her blood type is B. In such case her father may have blood type A,B, AB, and O. Thus, option C is correct.

What is blood group?

The three alleles that are A, B, and O are mainly responsible for controlling the major blood groups such as A, B, and AB, respectively. Due to this fact that humans are considered as diploid, each genotype could only include the maximum of two of them. Just to put it another way, just only two of these alleles could coexist in the single cell of the human at  given time.

IA, IB, and I are considered as the three distinct alleles that could determine the person's blood type. I has been considered as the most common. These three alleles could be referred to as the A (for IA), B (for IB), and O for the sake of simplicity (for i). Because we receive one blood type allele from our biological mother and one from our biological father, each of us has two ABO blood type alleles.

Therefore, option C is correct.

Learn more about blood on:

https://brainly.com/question/14781793

#SPJ3

Which of the following is true of ecological succession? A-pioneer organisms move into new communities first. B-primary productivity decreases as succession proceeds. C-secondary succession takes place within new communities with no previous soil. D-all of the above.

Answers

Answer:  Pioneer organisms move into new communities first.

Explanation:

THe video uses an example of cheerleaders at a sporting event,
building a pyramid as a definition of isostatic adjustment
A: True
B: False

Answers

I would agree with False because you can’t define adjustment like that

What is the meaning of life? (I’m Giving out 35 points)

Answers

Answer: do what makes you happy

Explanation:

Answer:

to live life to the fullest and appreciate the little things that make you happy and follow your dreams and just accept all the bad days because life isn't perfect and neither is everyone

How will water volume, incline gradient, and temperature affect the energy
of a stream?

Answers

Answer: Water Volume: The volume of water(discharge) in a stream affects the energy(velocity) of that stream. As the volume of the water in the stream increases, the velocity increases. ... Incline gradient: The incline gradient is also known as the slope of the stream.

Explanation:

What makes each of the mechanical layers different?

A. Whether the layer is rock or metal

B. Whether the layer is solid, liquid, or in between

C. Whether the layer is dense or thick

Answers

.......The answer is B

Generation Number of purple flowers Number of white flowers 1 705 224 2 792 189 3 834 102 4 889 84 5 938 21 6 952 0 Ralph wanted to breed a pea plant that produced only purple flowers. He continued to breed purple-flower producing pea plants together over six generations. The results of Ralph's artificial selection are shown above. What did artificial selection do to the population of pea plants? A. caused a new species of pea plant to form B. increased its genetic diversity C. decreased its genetic diversity D. caused a pea plant to exhibit a new characteristic

Answers

Answer:

C

Explanation:

The correct answer would be that artificial selection decreased the genetic diversity of the pea plant.

Genetic diversity is a measure of the number of traits or characters.

Initially, the breeding produced a considerable population of both white and purple flower offspring. But as time goes on, the population of purple flower offspring increased while that of the white flower decreased till it eventually reached zero.

Thus, artificial breeding reduced the number of traits in the population of the offspring from two to one - a case of reduction in genetic diversity.

The correct option is C.

Answer:

c

Explanation:

Which sediment would have the slowest rate of deposition?
a round sediment
O a very large sediment
an irregularly shaped sediment
O a high-density sediment

Answers

Answer:

C. An irregularly shaped sediment

Explanation:

Deposition is the settling of sediments within respective basins of deposition.

Irregularly shaped sediments are the slowest to settle within a basin this is due to the frictional resistance of their surface.

As these particles hits the water, the liquid drag on their edges is very great and prevents swift settling.

A. A high density sediment and a large sediment will have a fast settling time.

B. Rounded sediments will impose no friction on the water and they fall through the liquid very fast.

Answer:

the answer is C. an irregulary shaped sediment

Explanation:

hope this helps!

Please Help!
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is translated from left to right.

AUUUAACUGUUCUGUCUAGAG


1.

Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of amino acids, instead of just one set?

2.

Use Models Use the genetic code to translate the sequence into each of the three possible sets of amino acids.

3.

Draw Conclusions Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.

Answers

Answer:

TAA ATT GAC AAG ACA GAT CTC

1. The more bases there are per codon the more information you can code for. There are only 22 different amino acids, in consequence we need minimum 3 bases per codon.

2. codon

three nucleotides—called a triplet or codon—codes for one particular amino acid in the protein. The nucleotide sequence in the DNA is first transcribed into a molecule of messenger RNA (ribonucleic acid).

3. Known as alpha helices and beta sheets, these stable folding patterns make up the secondary structure of a protein. Most proteins contain multiple helices and sheets, in addition to other less common patterns (Figure 2). The ensemble of formations and folds in a single linear chain of amino acids — sometimes called a polypeptide — constitutes the tertiary structure of a protein. Finally, the quaternary structure of a protein refers to those macromolecules with multiple polypeptide chains or subunits.

OKAY I THINK EVERYTHING IS RIGHT BUT SORRY IF WRONG ;)

The mRNA sequence could be translated into three different sets of amino acids because of the degeneracy of the genetic code.
Using the genetic code to translate the mRNA sequence, we get the following three possible sets of amino acids:Set 1: isoleucine-phenylalanine-leucine-serine-valine-arginineSet 2: isoleucine-asparagine-valine-leucine-serine-arginineSet 3: isoleucine-asparagine-leucine-serine-valine-arginine

3. It is not possible to determine which of the three sets of amino acids is the most likely to be included in the polypeptide based solely on the information provided.

What is a nucleotide sequence?

A nucleotide sequence is the order of nucleotides (the building blocks of nucleic acids) in a DNA or RNA molecule.

Nucleotides are composed of a sugar, a phosphate group, and a nitrogenous base, which can be adenine (A), cytosine (C), guanine (G), thymine (T) (in DNA) or uracil (U) (in RNA). The specific order of these nucleotides in a DNA or RNA molecule determines the genetic information that the molecule carries.

Learn more about nucleotide sequence, here:

https://brainly.com/question/30299889

#SPJ6

a person suffering from cold doesn't get proper test why​

Answers

Because of the blood being frozen and your body reacts differently

Which statement describes an interaction between the biosphere and the atmosphere that is related to
photosynthesis?
O During photosynthesis, plant roots take in water from soil.
O During photosynthesis, plants take in carbon dioxide from the air.
O Through photosynthesis, energy stored in plants is released into the air.
O Through photosynthesis, energy stored in plants is transferred to humans who eat them.

Answers

Answer:During photosynthesis, plant roots take in water from soil.

Explanation:

Answer:

During photosynthesis, plants take in carbon dioxide from the air.

Explanation:

The second answer is correct because it includes an interaction between the atmosphere and the biosphere.

A doctor is diagnosing a patient with gigantism. Which of the following sources would be the least helpful in making
that diagnosis?
O growth chart
medical book
patient's family history
O patient's diet

Answers

Answer:

The answer is D, patient's diet.

Explanation:

As per the observation, it is clear that the correct answer is a medical book as it will have the medical history of the patient.

Gigantism is an extreme situation this is almost usually due to an adenoma, a tumor of the pituitary gland. Gigantism happens in sufferers who had immoderate boom hormones in childhood. The pituitary tumor cells secrete an excessive amount of boom hormone (GH), which main to many adjustments withinside the body.

How is gigantism diagnosed?

If gigantism is suspected, the prognosis is commonly shown via way of means of taking blood assessments to degree the stages of boom hormone and insulin-like boom component 1 (IGF1) circulating withinside the blood. IGF1 is launched into the blood often via way of means of the liver in reaction to boom hormone.

Thus it is clear that medical books will have a medical history of patetint wityh gigantism.

To learn more about gigantism refer to the link :

https://brainly.com/question/7035609

Identify part A, B and C. What is the function of part B?

Answers

A-fallopian tubes
B-uterus
C-ovaries

The uterus is the place where the fetus develops

Second part:
17. What are gremline cells

18. How is mitosis different from meiosis?

Answers

Answer:

just see explainnation

Explanation:

what is gremline cells tell me and the teach me what is mitisis ok and then teach me meiosis ok the I will tell u answer of thes question

FILL IN THE BLANK!!!

genotype is the____pair of alleles (TT)____of an organism. And phenotype is the____apperence__of an organism​

Answers

Answer:

THIS IS IT

Explanation:

The genetic makeup of an organism (ex: TT). Phenotype, The physical ... from each parent). This pair of alleles is called a genotype and determines the organism's appearance, or phenotype. ... A Punnett square can be used to predict genotype and phenotypes of offspring from genetic crosses

Scientists are studying the bacteria living in termites because they want to
genetically engineer......

Bacteria that can resist pests on crops.

Bacteria that can create ethanol from left over plant material.

Bacteria that create a vaccine.

Bacteria that create antibiotics.

Answers

Answer:

B. this is why Those bacteria may contain genes that will help convert plant material to ethanol. so B. and if it's wrong then sorry but if it's right u welcome ;)

Bacteria that can resist pests on crops.

The following information should be considered:

In the case when the scientist should studying the bacteria that lived the termites so it should resisted the pest on the crops. These kind of bacterias should comprise of genes that would helps transform plant material to ethanol.

Learn more: https://brainly.com/question/5303391?referrer=searchResults

whitch of the following nutrients is primarily used for building and repairing of demaged cells and tissues

Answers

Answer: protein ..i hope this helped!

Explanation: protein is a nutrient used to make and repair our body cells like blood and muscle cells.

Answer:

Explanation:

he is correct

can someone pleasee answer thiiisss pleasee

Answers

Answer:

Hi how are you doing today Jasmine

Can anyone give me two mineral feed ingredients for poultry birds ?! 20 points for it

Answers

Answer: aragonite oyster shell crab meal

Explanation: aragonite is for calcium and oyster shell also has calcium. Crab meal provides small amounts of protein and minerals

Which of the following is true about moss sporophytes?
a. Sporophytes perform photosynthesis. C. Sporophyttes contain a single spore.
b. Sporophytes depend on the gametophyte for d. Sporophytes are very large.
nutrients.

Answers

Answer: sporophytes photosynthesise, particularly when immature, but depend on gametophytes for at least 50% of nutrient requirements

Explanation: In mosses, the gametophyte generation is the dominant generation unlike in higher plants. The diploid sporophyte generation produces several spores per capsule.

Answer:

c

Explanation:

List and explain the 3 paths natural selection can take.

Answers

Answer:

1. Stabilizing Selection  

2. Directional Selection  

3. Disruptive Selection  

Explanation:

Stabilizing Selection  

This type of natural selection occurs when there are selective pressures working against two extremes of a trait and therefore the intermediate or “middle” trait is selected for. If we look at a distribution of traits in the population, it is noticeable that a standard distribution is followed:

Example:  For a plant, the plants that are very tall are exposed to more wind and are at risk of being blown over. The plants that are very short fail to get enough sunlight to prosper. Therefore, the plants that are a middle height between the two get both enough sunlight and protection from the wind.

Directional Selection  

This type of natural selection occurs when selective pressures are working in favour of one extreme of a trait. Therefore when looking at a distribution of traits in a population, a graph tends to lean more to one side:

Example: Giraffes with the longest necks are able to reach more leaves to each. Selective pressures will work in the advantage of the longer neck giraffes and therefore the distribution of the trait within the population will shift towards the longer neck trait.

Disruptive Selection  

This type of natural selection occurs when selective pressures are working in favour of the two extremes and against the intermediate trait. This type of selection is not as common. When looking at a trait distribution, there are two higher peaks on both ends with a minimum in the middle as such:

Example: An area that has black, white and grey bunnies contains both black and white rocks. Both the traits for white and black will be favored by natural selection since they both prove useful for camouflage. The intermediate trait of grey does not prove as useful and therefore selective pressures act against the trait.

what are cork tissues? how are they formed?

Answers

Answer:

Cork is a protective tissue that separates the living cells of the plant from the outside environment. The formation of cork in the periderm is the result of the activity of a secondary meristem, the cork cambium, or phellogen.

Explanation:

Other Questions
what is an example of conduction?A: how energy travels from a campfire to your body.B: how the first few centimeters of the troposphere get heated.C: how most of the energy from the sun travels to Earths surface.D: how energy moves along with the rising of carbon dioxide particles in the air. Indefinite pronouns are only singular in form. True or False Currently, the U.K is banning all incoming flights due to the new virus strain. Is this a simple or compound sentence? The height of a boulder falling off a 500 meter cliff can be modeled using a quadratic equation. Part A: Write the quadratic equation to represent this situation. Part B: Determine the time it will take the boulder to reach the ground. Part C: In one paragraph, using your own words, explain your work in Steps A and B. Why were enslaved africans brought to the colonies? I what are some real life examples of Permeable and Impermeable How might a person'a cultural identities affect their experiences of social interaction? Which three statements about gravity and the formation of the solar system are true? O A. Gravity evenly distributed matter throughout the solar system. O B. Gravity held the pieces of forming planets together. I c. Gravity pulled most of the matter into the center of the solar system D. Gravity caused the planets and Sun to have spherical shapes. What is fiscal policy? A. The way Congress votes to approve new laws B. The way a government creates new banks C. The way a government determines the supply of money D. The way a government collects money and spends it on goods and services The population of a community of foxes is observed to fluctuate on a 10-year cycle due to variations in the availability of prey. When population measurements began (t=0, the population was 35 foxes. The growth rate in units of foxes>>year was observed to be P(t)=5+10sint/5a. What is the population 15 years later? 35 years later? b. Find the population P(t) at any timet0. THE CATCHER IN THE RYE Before writing a composition, it is best to it first. Hence, anandare very useful and effective in planning to write aAnis a sketch or framework of a text showing its important ideas anddetails. This is usually presented in headings and subheadings. On the other hand,are aids that show visual explanations of concepts and relationshipsamong ideas presented in texts. So, both are helpful in planning to write a composition. Please help me I need these answers How did Confucianism influence emperors of the late Yuan dynasty?They used Confucian rituals at palace events.They required all servants to practice Confucianism.They practiced Confucianism alongside Mongol rituals.They required civil service exams based on Confucianism. Columbian Exchange was good or bad over all The reaction of Pb+4 and O-2 produces the compound of aPb2O2 bPbO cPb2O dPbO2 please help me with this thankyou Need help asap1. All nonmetals (except hydrogen) have 8 valence electrons?True or False2. The N^-3 ion is classified as a(n) ____ and has ____.A. anion, 8 valence electronsB. cation, 8 valence electronsC. anion, 15 valence electronsD. anion, 3 valence electrons3. If two nonmetals react to form a compound and have very different _____ they form ____ bonds. If there is a small difference, then they form ____ bonds.A. ionization energy; covalent; nonpolar ionicB. electronegativity; nonpolar covalent; polar covalent.C. ionization energy, ionic, nonpolar covalentD. electronegativity, polar covalent, nonpolar covalent. What property would you use to find an equivalent expression for 8 + ( 7 + 9)? 16. Rita Dove describes her poem as: How to find words for the human heart and all the emotions we ascribe to it? The path is a veritable minefield of clichsthose well-intentioned, once-fresh expressions whose very popularity has rendered them useless, even laughable. When she describes the path "as a veritable minefield of clichs" she is using what part of figurative language? 1 point Simile Hyperbole Alliteration Metaphor