Crossing-over occurs
a. during prophase 2.
c. during prophase I.
b. during fertilization.
d. at the centromere

Answers

Answer 1
C. Prophase 1 crossing over occurs during prophase 1 of meiosis.
Answer 2
Answer : prophase I

Internets prove: Crossing over occurs only during prophase I.
The complex that temporarily forms between homologous chromosomes is only present in prophase I, making this the only opportunity the cell has to move DNA segments between the homologous pair.

Related Questions

how does Pteromyzon differ from scolidon and labeo fishes?
who answer this question in 10 seconds I'll mark his or her ans. as "BRAINLIST ANSWER"
It's my promise but the answer must not be copied from internet​

Answers

Answer:

Due to no jaws, no paired fins and scales on the body.

Explanation:

Pteromyzon fish is different from scolidon and labeo fishes because Pteromyzon fish is not a true fish. The main reason for this is that Pteromyzon fish is agnathous means having no jaws and it doesn't have paired fins and scales on their body while all these features are present on the body of  scolidon and labeo fishes so we can conclude from this discussion that Pteromyzon fish is different from scolidon and labeo fishes.

Name the features caused by wave erosion and label them in the order that they would
occur. Write a short description of each feature.
Hint. There are 6 features.

Answers

Caves

Sea cliffs, sea stacks, sea caves, sea arches, handlands, and wave-cut terraces.

one is missing but u can just check it on quizlet

(HELP PLEASE I WASNT IN SCHOOL YESTERDAY) All of these forms of energy are involved in the human body's everyday life EXCEPT
Group of answer choices

mechanical energy

thermal energy

nuclear energy

Answers

Answer:

I'm pretty sure it's nuclear energy.

Answer:

the answer is the last one hope it helps

Which of the following below, best describes a cell from bacteria?
A. A multicellular organism

B. A cell with many organelles

C. Multicellular, Eukaryote

D. Unicellular, prokaryote

Answers

A multicellular organism

✨Please help ✨due soon✨

Answers

Answer:

25%

Explanation:

i believe 25% because ita very rare

January comes once in 12 months. Saturday comes once in seven days and 12 noon comes once each day. How is this like the frequency of a wave?

Answers

This is because the frequency of of a wave is a number of repeating event per unit time.

Two offspring from same parents can have different phenotypes. How is this possible?​

Answers

Answer:

Genes come in different varieties, called alleles. Somatic cells contain two alleles for every gene, with one allele provided by each parent of an organism. However, an allele that is hidden, or not expressed by an organism, can still be passed on to that organism's offspring and expressed in a later generation.

Explanation:

Overdominance, in instance, happens when a heterozygote exhibits a more extreme phenotype than either of its parents.

What is heterozygote?

Heterozygote is defined as a person, animal, or other thing possessing a pair of different alleles of a specific gene, one of which is dominant and the other recessive. One normal allele and one mutated allele, or two distinct mutated alleles, can make up a heterozygous genotype.

The explanation is connected to the fact that each parent has two different gene pools. Furthermore, only 50 percent of each parent's DNA is transferred to their offspring. and that the portion that is passed down is random. Every child has a unique set of genes thanks to the interaction of all these influences.

Thus, overdominance, in instance, happens when a heterozygote exhibits a more extreme phenotype than either of its parents.

To learn more about heterozygote, refer to the link below:

https://brainly.com/question/12891396

#SPJ2

how does water pollution harm water ecosystems?

Answers

Answer:

the animals die due to the chemicals and stuff in the water

Explanation:

Animals that live in a water ecosystem could get poisoned and die of all the pollution in the water, and all the trash that enters the waters.

Fill in the blank: ______ is the process that splits rock when water seeps into cracks, then freezes and expands.
YES I WILL HAVE A LOT OF FILL IN THE BLANK GET READY

Answers

Answer:

Freeze-thaw

Explanation:

Answer:

frost wedging

Explanation:

Creep is a type of erosion caused by


glacial erosion

gravity erosion

gully erosion

wind erosion

Answers

Answer:  Understanding different types of erosion, by water or wind, can help us protect our soils. ... Causes. Gully development may be triggered by: cultivation or grazing on ... Gravity moves earth, rock and soil material downslope both slowly ... soil creep; earthflow; slumping; landslips; landslides; rock avalanches.

Explanation:

LI:
The diagram below compares the relative diameters of two planets in our solar system.
Which two planets have diameters that most closely resemble this comparison?
1.
Uranus and Neptune
2.
Jupiter and Saturn
3
Earth and Mars
4.
Mercury and Venus
Submit Answer

Answers

Answer:

1, uranus and neptune

Explanation:

i just did it

Based on the diagram above, the two planets having diameters that most closely resemble this comparison are: 1.  Uranus and Neptune.

A solar system is an astronomical system which comprises both the inner and outer planets alongside celestial bodies such as a Moon, that are typically in orbit (traveling) around the Sun in slightly elliptical orbits..  

Basically, the nine (9) planets that are found in the solar system orbiting around the sun include;

Mercury. Venus. Earth. Mars.Jupiter.Saturn.Uranus.Neptune.Pluto.

Generally, the planets found in the solar system vary considerably in terms of shape and size as shown below:

1.  Uranus and Neptune: the mean diameter of Uranus is 50,724 km (31,518.43 mi) while that of Neptune is 49,244 km (30598.8 mi).

2. Jupiter and Saturn: the mean diameter of Jupiter is 142,984 km (88,846 mi) while that of Saturn is 120,536 km (74897.6 mi).

3. Earth and Mars: the mean diameter of Earth is 12,756 km (7926 mi) while that of Mars is 6779 km (4212.275 mi).

4. Mercury and Venus: the mean diameter of Mercury is 4,879 km (3031.67 mi) while that of Venus is 12,104 km (7521 mi).

From the above data on diameter, we can deduce that both Uranus and Neptune are mostly related in terms of size as depicted in the diagram, by using two (2) circles of equal sizes.

Read more: https://brainly.com/question/1251115

Which cell type has organelles that are NOT membrane-bound, eukaryotic or prokaryotic? PLEASE HELP

Answers

The answer is prokaryotic

There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles​

Answers

Answer:

nucleus

Explanation:

chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.

The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.

What are eukaryotic cells?

Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.

There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.

The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.

Thus, the correct option is C. nucleus.

To learn more about eukaryotic cells, refer to the link:

https://brainly.com/question/982048

#SPJ6


Young grouse crouch motionless near the ground when threatened by a predator. Owls
have needle sharp talons for catching prey. Buffaloberry plants have thick leathery leaves
that reduce water loss in summer. Insects have a hard exoskeleton that provides support
and allows movement.
Which of the organisms described above show a behavioural adaptation?
Young grouse
Owl
Insects
Buffaloberry plants

Answers

Answer:

the young grouse cause it crouch motionless near the groundwhen threatened

at which temperature would air hold the least water vapor?

Answers

Answer: I believe it's 60 degrees Fahrenheit or less, Since heat is required to have proper evaporation, then this will only be leading to a portion of the water condensed leading to a half condensation

Explanation:

Answer:

the coldest temp in F holds the least amount of water vapor..

what do eukaryotic cells and viruses have in common?​

Answers

Answer:

Just search it up

Explanation:

Hello There!

What do viruses have in common with eukaryotic cells?

-Viruses are not cells, but they do have certain things in common.

Viruses & Eukaryotic cells :-

1.Contain DNA, but not much.

2.Can not reproduce by themselves.

3.Have important features such as nucleic acid gnomes.

4.Have genetic variations and can certainly evolve.

Hope This Helps!

Thank you!!! Good Day! ♡

Certain gene mutations can cause genetic disorders. However the same gene can also have a positive effect. The genetic mutation that led to sickle cell anemia can also give its carriers protection from which of the following diseases?
A.
strep throat
B.
Type I diabetes
C.
malaria
D.
hemophilia

Answers

B is the correct answer

Answer:

its malaria

Explanation:

I got it wrong and it showed me that it was malaria

Would you expect the stomata of a desert cactus or the stomata of a water lily plant to close during the day?

Answers

A water lily will have more stomata. A desert cactus will have very few stomata, because in deserts plants face water shortage so in order to avoid loss of water cacti have adapted to the desert environment by possessing few stomata.

The stomata of a desert cactus will close during the day.

STOMATA:

The stomata (singular- stoma) are structures on the leaves of a plant that helps in gaseous exchange i.e. entry and exit of CO2 and O2 gases.

The stomata, however, when opened allows the passage of water vapor from the plant. Hence, plants utilize the opening and closing of stomata to regulate water loss.

Desert cactus is a xerophytic plant meaning that they can survive in low water conditions. One way they adapt to their desert environment, which is characterized by low humidity, is by the closure of their stomata during the day.

Therefore, the stomata of a desert cactus will close during the day.

Learn more at: https://brainly.com/question/3387375?referrer=searchResults

The dodo bird is now extinct. What factor would not have led to its extinction?

Answers

Answer:it was well adapted to living on the island of Mauritius

Explanation:

Which of these is the form in which
igneous rock begins?
A. sediment
B. magma
C. carbon
D. soil

Answers

Answer:

B)Magma

Explanation:

The energy related to the motion of an object is called ___.

Answers

Answer:

The answer is  kinetic energy

Explanation:

Kinetic energy is the correct answer

The diagram shows the moving molecules in a beaker of liquid. What will happen if the molecules increase their speed?

A.
the liquid will become a solid

B.
the temperature of the liquid will increase

C.
the temperature of the liquid will decrease

D.
the molecules will gain mass

Answers

Answer:

I believe the answer to this question is B

The image below shows plant cells.
What feature of cells is best demonstrated in the image?
OA Cells are the basic units of structure and make up tissues.
OB. All organisms are made up of a large number of cells.
OC. All organisms have cells with different shapes and functions.
OD. Cells are formed from other cells within the same tissue.
2021 Edmentum. All rights reserved.

Answers

C.All organisms have cells with different shapes and functions

Which best describes the importance of meiosis to living organisms? *
O genetic variation and growth
O growth and development
O development and sexual reproduction
O sexual reproduction and genetic variation

Answers

Answer:
Sexual Reproduction and genetic variation

Explanation:

Meiosis is important for three main reasons: it allows sexual reproduction of diploid organisms, it enables genetic diversity, and it aids the repair of genetic defects.

When a strong acid is added to a strong base a_________________ reaction occurs in the product will have a PH closer to_____

A. Neutralization,7
B. Ionic,0
C. Concentration,14

Answers

Answer:

A

Explanation:

Acids and bases when mixed neutralize eachother. and 7 is neutral on the PH scale

lee and Celia are lab partners. While Celia pours a chemical into a graduated cylinder, some of the chemical splashed onto her arm . What should happen next?

Answers

Answer:

Celia should tell the teacher and wash her hands and arms twice.

Explanation:

She should tell the teacher because if she is unsure of what to do, the teacher can help her. If there is no teacher present, she should wash her hands and arms twice to remove as much of the chemical as possible. Then she should call a poison help or chemical help center if she is unsure of what to do next.

.... she should lesson to her teacher

The table below shows the initial and final masses of a radioactive material whose half-life is 15 years.

Initial mass (in kilograms): 0.8
Final mass (in kilograms): 0.05

Based on the table, which of these conclusions is correct?

A.) The material decayed from 0.8 kilograms to 0.05 kilogram in 60 years.
B.) The material decayed from 0.8 kilograms to 0.05 kilogram in 30 years.
C.)The mass of the material was 0.1 kilograms after four half lives.
D.) The mass of the material was 0.1 kilograms after five half lives.

Answers

Answer:

A

Explanation:

1 half-life = .4 kg = 15 years

2 half-life = .2 kg = 30 years

3 half-life = .1 kg = 45 years

4 half-life = .05 kg = 60 years

Answer:

A

Explanation:

Initial mass is 8. The half-life is 15 years.

1st half life=.8/2=.4

2nd half life=.4/2=.2

3rd half life=.2/2=.1

4th half life=.1/2=.05

For each half life that it took it to go from .8 to 0.05, you add 15 years since that is the half life of the substance. 4*15=60.

So, the answer is A. The material decayed from 0.8 kilograms to 0.05 kilogram in 60 years.

5. The sodium-potassium pump is an example of
i. simple diffusion.
j. passive transport.
facilitated diffusion.
k. none of the above

Answers

Answer:

its passive transport

Explanation:

The sodium-potassium pump sets the membrane potential of the neuron by keeping the concentrations of Na+ and K+ at constant disequilibrium.

K

The Sodium-Potassium Pump. Active transport is the energy-requiring process of pumping molecules and ions across membranes "uphill" - against a concentration gradient. ... In active transport, as carrier proteins are used to move materials against their concentration gradient, these proteins are known as pumps.

Michael loves playing his clarinet and believes it attracts more rabbits than any other instrument he
has played. In order to test his hypothesis, Michael played a song on his clarinet for a total of 5
minutes and counted the number of rabbits he saw in his front yard. He played the song a total of 3
times on his clarinet and repeated the experiment using a flute and a guitar. He also recorded the
number of rabbits he observed when he was not playing an instrument. The results are shown in the
chart.
Number of Rabbits
TRIAL
NO MUSIC
CLARINET
FLUTE
GUITAR
15
1
2
3
5
3
2
10
12
5
8
9
12
18
7
1) What is the independent variable?
2) What is the dependent variable?
3) What is the experimental group?
4) What is the control group?
5) What is one constant from the experiment above??

Answers

Answer:

Independent variable: type of instrument

Dependent variable: Number of rabbits attracted

Experimental group: The group when he played an instrument

Control group: The group when not playing an instrument

Constant: Same song

Explanation:

1. Independent variable is the variable that the experimenter changes or manipulates in an experiment. In this experiment, the variable that is changed is the TYPE OF INSTRUMENT used (clarinet, flute, guitar), hence, it is the independent variable.

2. Dependent variable is the variable that is measured in an experiment. It is the variable that responds to the changes made to the independent variable. In this experiment, the dependent variable is the "NUMBER OF RABBITS ATTRACTED" by the instrument played.

3. Experimental group is the group of an experiment that receives experiment treatment, which is the independent variable. In this case, the experimental group is the GROUP IN WHICH INSTRUMENT WAS PLAYED.

4. Control group is the group that does not receive the experimental treatment. In this case, the control group is the group in which INSTRUMENT WAS NOT PLAYED.

5. Constants are those variables that remains unchanged for all groups throughout the experiment. In this case, one constant is the SAME SONG played.

23. Which of the below names is not a type of biologist?
a) paleontologist
b) botanist
I
c) zoologist
d) astrophysicist
BA

Answers

Answer:

D

explanation: it literally has physics in its name

Other Questions
PLS ANSWER ASAP. ILL GIVE BRAINLIEST! Match the system for each of the following bodily organs.1.Nose a. Skeletal System2.Skull b. Circulatory System3.Kidneys c. Urinary System4.Veins d. Respiratory System plz help timed MATHHHH 12 pointes Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) Select one of the readings in this unit, EXCEPT the Gettysburg Address, and in at least 150 words, discuss the historical context or cultural context the author demonstrates. How did Tisquantum help the Pilgrims????i will give brainliest and extra points Find the value of x in the image Read and choose the option with the regular verb in the imperfect tense.La princesa ley el libro.El rey no hablaba.La reina fue a la torre.El prncipe tom caf, Do you believe that parents should have all of the powers described in the Parents Constitution? Why or why not? kareem drew a diagram to compare flatworms and segmented worms which label belongs in the area marked X?a. can reproduce sexuallyb. are always parasites c. are all sessiled. are covered in setaePLEASE HELP Someone pls help me with both :( An ant bed contains about 230 ants. If there are 6 of these beds on the playground, how many ants are there? What was an effect of the Teapot Dome scandal?A. It increased public support for U.S. membership in the League ofNations.B. It increased public support for signing the Treaty of Versailles.O C. It resulted in laws passed by Congress to reform federal elections.D. It confirmed public concerns about relationships betweenbusiness and the Harding administration. Can yiu ANSWER ALL OF THEESE QUESTIONS :1.Its cost $10.00 for 20 oranges. Is $2.00 per orange accurate? 2.Find the unit rate for 5 cans of chicken soup that cost a total of $2.00. 11. Cheetahs have been through a genetic bottleneck; evidence for this is thatA little natural selection occurs in this species.B. the body is long thin, and graceful.c. there is very little genetic variability.D. these cats are members of an endangered species.E. they originally came from sm all areas of Africa. What is the x-coordinate of the point shown in the graph?y84-22 24B-8-6-4-2-24 A. they occurred before because the end of the Ptolemaic dynasty corresponds to the birth of Christ B. they occurred after because BCE is an abbreviation that translates to in the year of our lord C. they occurred before because BCE is the same time period as BCE which means before Christ D. they occurred after because the Egyptian old kingdom marks the beginning of the common era What is the square root of -16? white and informative essay about why or why not wearing school uniforms would be beneficial to students and school district HELP ASAP!!Which of the following depicts early city life?Running water was a great benefit.There was a remendous lack of space.It was very inexpensive to live in the city.City life made one feel independent. please awnser the photo with the word