Can someone pls help... I'm stuck...

When did time begin?

Answers

Answer 1

Answer:

There is no exact date, but scientists believe it started around 13 Billion years ago.

Explanation:

Hope this Helps!

:D

Answer 2

Answer:

13.7 billion years ago

Explanation:


Related Questions

How is the vice president of the United States selected?

A. The vice president is elected by a vote in the Senate.
B. The vice president is elected by a vote in the House.
C. The vice president is elected with the president.
D. The vice president is appointed by the president.

Answers

Answer:

it c

Explanationthe other person wrong

Answer:

c is the answer

Explanation:

edrfghjhgfdsa

I need help with this someone answer this ASAP!!

Answers

mesopotamia should be the answer
I think it’s Mesopotamia

Decode this please-------------

Answers

Answer:

REK2VI Is all i got

Explanation:

REK2VI is what i got too not sure though

(7th grade history) Native american groups from which area were first and most affected by this systematic extermination of a natural resource?

Answers

Answer:

North Central Plains

Explanation:

Hope this helps

north central plains !

True or False?....The purchase of Louisiana was a tremendous deal as we acquired about 828,000 acres for $15 million, a price of less than 3 cents an acre

Answers

Answer:

True

Explanation:

true (make me brainiest i need points pls)

True or false: After returning from their journey, Lewis became Governor of the Louisiana Territory while Clark became Governor of the Missouri Territory. They both lived long happy lives.

Answers

Answer:

i am 95% sure that it is true

The answer is false

Which of the following are qualifications to register to vote in Virginia? (Choose 3)

At least 18 years of age by day of registration

Have a drivers license

At least 18 years of age by day of general election

Citizen of the United States

Resident of Virginia

Answers

Answer:

the answer is d b a I'm pretty sure those are right

Answer:

A B D

Explanation:

You have to be 18 years or older to vote

You must have some identification to indicate that you are the person you say you are

In 1996 they passed a law saying that you must be a United States citizen to vote otherwise you can't participate in any voting

What instruments were used to navigate the Missouri River? (select ALL that apply)

Answers

Answer: All of them are correct.

Explanation: I did the puzzle in class today

Paddles, poles, sails and ropes were used to navigate the Missouri River. Thus, all options are correct.

What is the peculiarity about Missouri River?

The Missouri River is the country's longest river. The Missouri River rises in the Eastern Centennial Mountains in Southwestern Montana's Rocky Mountains and travels 2,341 miles east and south until joining the Mississippi River north of St. Louis, Missouri.

More than 500,000 square miles of sparsely inhabited, semi-arid basin, including portions of ten U.S. states and two Canadian provinces, are drained by the river.

Although the Missouri River is a tributary of the Mississippi, it is substantially longer and transports a similar amount of water. It joins the lower Mississippi River to create the fourth-longest river system in the world.

People have relied on the Missouri River and its tributaries as a source of food and transportation for over 12,000 years.

Learn more about Missouri River, here

https://brainly.com/question/28604557

#SPJ2

 

help qwq im not smart lol

Answers

Answer:

Its A

Explanation:

Please mark me brainliest it would mean a lot

Explain the reasoning behind Caesar's assassination. Why did the members of that conspiratorial group choose the date, place, and means they did?

Answers

Answer:

Brutus decides to join the conspiracy against Caesar after his realization to the fact that the Roman Republican government was in great danger. Caesar had himself declared himself dictator for life. (the ancient Roman position of dictator was defined as a necessary governmeantal position in times of crisis, not to be confused with the modern definition of dictator) However, Caesar's power grew ever stronger and Brutus saw this as tyrannical.The Senate to which Brutus was a member became nothing more than a puppet on the hand of Caesar.The love Brutus had towards the Republican principle and the sense of duty to secure that principle ultimately forces him to choose between a man he greatly admired and the political philosophy which was to serve the greater good. In his mind Brutus was doing what was "noble" and morally right, in this manner the assassination of Caesar had moral and political justification

Explanation:

answer credit:  iamrohitroshan

Identify the main reasons for settling in North America?
Location:
Political/ Government:
Economic reasons:
Religious reasons:
Economics and social reasons:

Answers

Answer:

Religious reasons

Explanation:

Most people that came here were because they wanted to escape persecution. Many people were persecuted for their relgious beliefs so they came here.

Religious reasons that’s to easy man and thanks for the points

What is the difference between patriotism and treason?

Answers

Answer:

Patriotism:the quality of being patriotic; devotion to and vigorous support for one's country.

Treason:the crime of betraying one's country, especially by attempting to kill the sovereign or overthrow the government.

Patriotism is being proud and supporting a country while Treason is being against and trying to overthrow a country/government.

Answer:

patriotism :the quality of being patriotic; devotion to and vigorous support for one's country.treason :the crime of betraying one's country, especially by attempting to kill the sovereign or overthrow the government.

one is good the other is bad one wants to ruin the other wants to change and make better hope it helps have a good day.

Explanation:

Who watched to the news yesterday night

Answers

Answer:

I did ,but i could only watch some of it since it was late at night

Explanation:

Me :))))) yessssssss

hey guys i need help w/ this

Answers

Answer:

britain stamp act is the taxation on newspaper and other things. sugar act is the taxation on sugar,tea etc

I think I helped

Answer:

1. Some colonists protested by sending messages to Parliament. Others carried banners saying “The folly of England, The Ruin of America’ through the streets of New York”

2. Baron Friedrich was a Prussian soldier designed inspector general of the America Continental Army. He was in charge of trading troops in 1778 during the period of the America Revolutionary War.

3. Marquis de Lafayette was a French aristocrat who fought in the Continental Army with the American colonists against the British in the American Revolution.

Explanation:

What kinds of goods were sold in the ranch general store?

Answers

Answer:

A general merchant store is a rural or small-town store that carries a general line of ... General stores often sell staple food items such as milk and bread, and various ... The growing need for imported goods, both from European settlers and the

Explanation:

❤️‍♀️‍♀️

Answer:

vegetable, fruits, Milk, bread, thats all got 0_0

Explanation:

How did nations try to make adjustments during ww1?
What was the result?

Answers

They fought until one of them died or gave up. The result was your welcome
The aftermath of World War I saw drastic political, cultural, economic, and social change across Eurasia, Africa, and even in areas outside those that were directly involved. Four empires collapsed due to the war, old countries were abolished, new ones were formed, boundaries were redrawn, international organizations were established, and many new and old ideologies took a firm hold in people's minds. World War I also had the effect of bringing political transformation to most of the principal parties involved in the conflict, transforming them into electoral democracies by bringing near-universal suffrage for the first time in history, as in Germany (1919 German federal election), Great Britain (1918 United Kingdom general election), and Turkey (1923 Turkish general election

all you need to know is in pic below

Answers

I guess you have the answer but thanks for the points!!

Plssssss Help!!!
Aesop’s fables usually end with a lesson about how to act. Describe have a Greek family might tell the stories to educate their children. Use “slow and steady wins the race“ in your description.

Answers

Greek people would use these fables to inspire and teach their children morals and the correct ways to do things. Some stories talk about problem solving, being kind, or being slow and steady wins the race.

Can someone write an Analytical Paragraph about the louisiana purchase? I gave away my hundred points but here's 23. please help it would mean a lot

Answers

Answer: The Louisiana Purchase eventually doubled the size of the United States, greatly strengthened the country materially and strategically, provided a powerful impetus to westward expansion, and confirmed the doctrine of implied powers of the federal Constitution.

(This might not be what you’re looking for, but I tried)

Explanation:

The Louisiana Purchase in 1803 represented the time when the United States expanded to the West by buying an area previously owned by France for the price of 15 million dollars.[2] The purchase represented the major diplomatic success of a young nation and an opportunity to double its size and become a leading power. The area purchased would later become “the states of Arkansas, Missouri, Iowa, Nebraska, South Dakota, almost all of Oklahoma and Kansas, and large portions of what is now North Dakota, Montana, Wyoming, Minnesota, Colorado, and Louisiana.”[3] The treaty represented an interesting view of the relations between France and the US that promoted the sale of Louisiana by Napoleon Bonaparte. Additionally, the treaty also served to bring in a major political battlefield between the Federalists and Republicans concerning Article III of the treaty, raising the questions of whether the president can sign treaties and incorporate new people of a gained territory into the union. This research paper will analyze the treaty and delve into the context behind the purchase of Louisiana by dividing it into three parts: the first part devoted to the relations between France and the US, the second to the provision of the treaty and the third to the consequences of the treaty on the constitution and its interpretation.

Wrote a whole essay for you my boy

1. What factors led to the expansion of slave labor in the Southern Colonies?

2. Describe the backcountry. Then how did the environment of the backcountry affect how people settling there made a living?

3. How did enslaved persons on plantations improve their living conditions and protest their working conditions?

4. Why is studying slavery important to our understanding of our nation’s past AND present? Explain using at least three reasons why. Your reasons should be based on historical fact.

Answers

1. They began establishing plantation farms for cash crops, tobacco and sugar cane enterprises that required increasing mounts of labor

Yeah I only know the answer to the 1st one ...

Paul and Silas showed their love to God by praising Him.



TrueFalse

if u steal my points i will report

Answers

Answer:

well its true

Explanation:

Why did the Roman Empire decline?

Select all correct answers.


Budget deficits caused by low taxes on Roman citizens led to increased public debt and helped topple the central government.


Germanic tribes, Parthians, and North Africans pressed attacks against the empire's frontiers from all sides.


Roman troops returning from the Middle East brought a plague into the capital that killed up to 10 percent of the city's population.


A series of brutal and incompetent emperors squandered huge sums and led to public disgust with the imperial government.

Answers

Answer: I think budget deficits caused by low taxes and a series of brutal and incompetent emperors would both be the answer to your question.

Explanation:

Answer:

Germanic tribes, Parthians, and North Africans pressed attacks against the empire's frontiers from all sides.

Roman troops returning from the Middle East brought a plague into the capital that killed up to 10 percent of the city's population

A series of brutal and incompetent emperors squandered huge sums and led to public disgust with the imperial government.

Explanation:I took the test

Are people racially profiled by the Police? why or why not, explain please

Answers

Racial Profiling" refers to the discriminatory practice by law enforcement officials of targeting individuals for suspicion of crime based on the individual's race, ethnicity, religion or national origin. Criminal profiling, generally, as practiced by police, is the reliance on a group of characteristics they believe to be associated with crime. Examples of racial profiling are the use of race to determine which drivers to stop for minor traffic violations (commonly referred to as "driving while black or brown"), or the use of race to determine which pedestrians to search for illegal contraband.

Why do you think a draw is considered a win for the Americans?

Answers

A draw is probably a win because it’s a random pick and it’s being chosen fairly (without one person competing with the other)

Answer:

because life is not fair.

Explanation:

life is not fir because not everyone has the same chances in life.

What was the main reason that Athens and Sparta fought the Peloponnesian War?

A.
Sparta wanted to overthrow the Athenian oligarchy.
B.
Athens wanted to become the most powerful city-state in Greece.
C.
Sparta and its allies felt threatened by Athens’s growing power.
D.
Athens wanted to control the biggest navy in ancient Greece.

Answers

Sparta wanted to overthrow the Athenian oligarchy. Athens wanted to become the most powerful city-state in Greece. Sparta and its allies felt threatened by Athens's growing power.

Answer:

the answer is C) Sparta and its allies felt threatened by Athens's growing power.

Explanation: hope this helps

Read the map.


A map titled Spread of Hinduism. A key shows Expansion routes with a red arrow. The Himalaya Mountains are along the border between India and China. Beginning near the eastern coast of India, arrows point southeast to Sri Lanka, Sumatra, Java, Indonesia, Malaysia, Philippines, Thailand, Cambodia, and Myanmar (Burma).


What does the map show about the spread of Hinduism?


Hinduism spread to areas of western India along trading routes.

Hinduism did not expand beyond the natural borders of India.

Hinduism spread primarily to areas east and south of India.

Hinduism was hindered by natural barriers from spreading to other regions.

Answers

Answer:

answer c mark brainleist

Explanation:

Answer: c

Explanation:

The fields in the South were worked by:

indentured servants
immigrants
slaves
Seminole Native Americans

Answers

they were worked by slaves

the fields in the south were worked by slaves

!HELP! !!WILL MARK BRAINLIEST!!

Use the passage to answer the following question:

"I can see no reason to doubt but the imposition of taxes, whether on trade, or on land, or houses, or ships, on real or personal, fixed ort floating property, in the colonies is absolutely irreconcilable with the rights of the colonists as British subjects and as men. I say men, for in a state of nature no man can take my property from me without my consent: if he does, he deprives me of my liberty and makes me a slave."
—James Otis, 1763

Based on this excerpt, what do you think Otis's purpose was in writing this document?

To sell
To describe
To conquer
To persuade

Answers

Answer:

3

Explanation:

Answer:

4. To persuade

Explanation:

Otis wants to persuade the audience that this is an unfair situation.

NEED HELP ASAP DUE 11:30PM !
Which descriptions of the English colonies in North America are accurate?



Choose all answers that are correct.

Question 46 options:

The king granted a lot of self-government to Massachusetts and other colonies in the hope they would send back raw materials and would start paying taxes.


The men on the Mayflower signed an agreement to write fair laws for the good of the colony.


Virginia planters paid English laborers good wages to come work on their plantations.


Jamestown was established on good ground near clean water in a healthy environment.


Only about 1 in 5, or 20 percent, of early colonists in Virginia survived

Answers

Answer:

The following are accurate:

Only about 1 in 5, or 20 percent, of early colonists in Virginia survived

The men on the Mayflower signed an agreement to write fair laws for the good of the colony.

The king granted a lot of self-government to Massachusetts and other colonies in the hope they would send back raw materials and would start paying taxes.

I hope these are correct, good luck <3

Answer:

Only about 1 in 5, or 20 percent, of early colonists in Virginia, survived.

The men on the Mayflower signed an agreement to write fair laws for the good of the colony.

The king granted a lot of self-government to Massachusetts and other colonies in the hope they would send back raw materials and would start paying taxes.

I know this! :)

9. We elect people to the state legislature to represent our wishes. What do we call this
principle of government?

A. liberty of the people
B. checks and balances
C. separation
D. representative government

Answers

Answer:

B. Checks and balances

b) checks and balances

Other Questions
Read this excerpt from the Supreme Court's Hazelwood v. Kuhlmeier dissenting opinion: The state educator's undeniable, and undeniably vital, mandate to [teach] moral and political values is not a general warrant to act as "thought police" stifling discussion of all but state-approved topics. . . . Official censorship of student speech on the ground that it addresses "potentially sensitive topics" is . . . impermissible.4 The reasoning in this opinion is most similar to the reasoning in which other Supreme Court ruling? A. New Jersey v. T.L.O. B. Miranda v. Arizona C. Gideon v. Wainwright D. Tinker v. Des Moines pls help asap!! no trolls 1. Many plants can reproduce asexually. How is this an advantage for the plant? Why can it sometimes be a disadvantagefor the plant? Use details to support your answer. PLS ANSWER ASAP. ILL GIVE BRAINLIEST! Match the system for each of the following bodily organs.1.Nose a. Skeletal System2.Skull b. Circulatory System3.Kidneys c. Urinary System4.Veins d. Respiratory System 2 Which piece of evidence explains WHY the five themes of geography were created (A) In 1984. educators sought to better organize the teaching of geography in kindergarten through 12th grade classrooms. (B) The themes were created by the National Council for Geographic Education and the Association of American Geographers. (C) While these five themes have been since replaced by the National Geography Standards, they still provide an effective organization for the teaching of geography (D) Humans shape the landscape through their interaction with the land; this has both positive and negative effects on the environment Fill in the blank with the appropriate preposition.Paris est _____________ New York.a.) prs deb.) loin dec.) surd.) dans plz help timed MATHHHH 12 pointes Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) Select one of the readings in this unit, EXCEPT the Gettysburg Address, and in at least 150 words, discuss the historical context or cultural context the author demonstrates. i cant ever forgive the vampire diaries producers and directors for killing enzo but letting ratty matty the human LIVE?? like why did they keep matt alive when no one liked him but KILLED ENZOOOOOO How did Tisquantum help the Pilgrims????i will give brainliest and extra points Find the value of x in the image I need helppppp with this please Read and choose the option with the regular verb in the imperfect tense.La princesa ley el libro.El rey no hablaba.La reina fue a la torre.El prncipe tom caf, Do you believe that parents should have all of the powers described in the Parents Constitution? Why or why not? answer the pic below How can you use density to separate mixtures like sand and small plastic pellets? What is the x- coordinate of the zero of the graphed line? How does the setting influence the theme of the story (pieces in the past ) story 15 points Why do you think that some bacteria/diseases are harder to eradicate than others?