Why must an mRNA copy be made for Protein Synthesis?
A. Ribosomes cannot read DNA, only RNA.
B. DNA must stay inside the nucleus.
C. Ribosomes are too big to enter the nucleus.
D. DNA is too degenerate to use without mRNA.

Answers

Answer 1

Answer:

A

Explanation:

its not D or C and B might be true but its A okay

Answer 2

Why must an mRNA copy be made for Protein Synthesis because C. Ribosomes are too big to enter the nucleus

Why is mRNA important for protein synthesis?

mRNA is the molecule that includes the message contained within DNA to the ribosome. Ribosomes are where proteins are produced. mRNA is vital because ribosomes cannot attain the DNA inside our cell nucleus, which is the region within the mobile wherein DNA is housed.

Why is it important to make an mRNA reproduction of a DNA gene earlier than protein synthesis?

So as for cellular to fabricate these proteins, particular genes inside its DNA should first be transcribed into molecules of mRNA; then, these transcripts must be translated into chains of amino acids, which later fold into completely useful proteins.

Learn more about Ribosomes at https://brainly.com/question/8773679

#SPJ2


Related Questions

When you step
on a scale, what is being
measured?

Answers

Answer:

Although scales measure force, they give you measurements of mass in kilograms, grams, pounds, or whatever.

Explanation:

What the person above me said is correct


Explanation it’s correct I’m positive

Why most foods needs to be digested? Give at least 3 reasons

Answers

Answer:

Why most foods needs to be digested? Give at least 3 reasons.

Explanation:

Foods must be digested cause of the following reasons:

1. To get energy the food must be digested.

2. To provide nourishing vitamins and minerals to our body.

3. You will be affected by some diseases if you didn't digest your food.

In mature animals when do cells still need to differentiate?

Answers

Answer:

As an organism develops, cells differentiate to form different types of cells. Most types of animal cell differentiate at an early stage. Many types of plant cells retain the ability to differentiate throughout life. In mature animals, cell division is mainly restricted to repair and replacement.

Explanation:

''.''

In mature animals cells differentiate during : Repair and replacement of  animal cells

Cells differentiate in organisms and plants to create more cell types, as the organism and plants continue to mature. While cell differentiation in animals occur mostly before maturity, plants cells continue to differentiate until they die.

While in mature animals, cells differentiates at maturity only when the cells of the mature animal needs repair or replacement due to damage caused to the a cell or tissue.

Hence we can conclude that in mature animals cells differentiate during repair and replacement of cells.

Learn more : https://brainly.com/question/19015367

Can someone please help me I don't understand the and my parents don't under please

Answers

432hz x 432hz = 2228

Explanation:

the simple explanation is shushh

Look at the graph below. A graph is shown with Absolute magnitude shown on y axis and Surface temperature in degree Celsius shown on x axis. The Dwarf stars are shown along a slanting line from coordinates 30,000 and minus 3 to 10,000 and minus 4. The Main Sequence stars are shown along a slanting line from coordinates 20,000 and minus 2 to 2,000 and minus 6. The giants are shown along a line parallel to the x axis from coordinates 5,000 and 2 to 2,000 and 3. The supergiants are shown along a line parallel to the x axis from coordinates 7,500 and 4 to 2,500 and 4. Point A has coordinates 20,000 and minus 4. Point B has coordinates 2,500 and minus 4. Point C has coordinates 5,000 and 2. Point D has coordinates 7,000 and 4. Which of the following stars is most likely to be red? Star A Star B Star C Star D

Answers

Answer:

Star A

Explanation:

If you look directly at the diagram, the dwarf stars are labeled under 'A' and are the least in mass and temperature.

Being the smallest and coldest, dwarf stars most commonly have red coloration, which would make them the obvious choice.

Star A which is a dwarf star has the coldest temperature, and therefore is a red star since red stars are the coldest stars.

What are stars?

Stars are a large self-luminous bodies whichbpriducw large amounts of heat energy and light energy as a result of the nuclear reactions occurring within them.

Stars have different colors and different sizes.

Red stars are the coldest stars and also the least massive.

From the chart, Star A which is a dwarf star has the coldest temperature, and therefore is a red star.

Learn more about red stars at: https://brainly.com/question/11562269

#SPJ2

Which statement is part of the cell theory?
A Single-celled organisms are made of one cell.
B Cells are different in size and shape.
C All cells come from other living cells.
D Cells sometimes only have one job.

Answers

Answer:

I believe it's C, all cells come from other living cells.

Answer 15 and 16 correctly and I will mark as brainliest

Answers

Answer:

I think its A and G

Answer:

15. B.

16. H

Explanation:

how do you think the idea of sustainability influences the work of foresters?



help me

Answers

It’s funny because the concept of sustainability is thought to come from field of forestry. Around the year 1700, Carl von Carlowitz described the concept of sustainable forestry.

What is the definition of a DNA Polymerase

A. Enzyme involved in DNA replication that joins individual nucleotides to produce a DNA molecule
B. An enzyme that unwinds the DNA double helix during DNA replication
C. A class of nucleotides that includes adenine and guanine.
D. A bond between complimentary base pairs in DNA​

Answers

A. I hope this hopes


Which is not a likely economic tool to address environmental issues?
Emissions fees and taxes

Responsibility for a product from production to disposal

Small business liability relief

Defunding government regulation

Answers

Explanation:

Policy-makers have two broad types of instruments available for changing consumption and production habits in society. They can use traditional regulatory approaches (sometimes referred to as command-and-control approaches) that set specific standards across polluters, or they can use economic incentive or market-based policies that rely on market forces to correct for producer and consumer behavior. Incentives are extensively discussed in several EPA reports

Two basic types of traditional regulatory approaches exist. The first, a technology or design standard, mandates specific control technologies or production processes that polluters must use to meet an emissions standard. The second, a performance-based standard, also requires that polluters meet an emissions standard, but allows the polluters to choose any available method to meet that standard. Performance-based standards that are technology-based, for example, do not specify a particular technology, but rather consider what available and affordable technologies can achieve when establishing a limit on emissions. At times, EPA may completely ban or phase out the use or production of a particular product or pollutant, as it has done with chlorofluorocarbons (CFCs) and certain pesticides. Regulations can be uniform or can vary according to size of the polluting entity, production processes, or similar factors. Regulations are often tailored in this manner so that similar regulated entities are treated equally. MARK AS BRAINLIEST IF IT HELPS

which is NOT part of the cell theory?

A) all living thing a are composed of cells
B) Cells are the building blocks of germs
C) All cells come from other cells
D) Cells are the basic units of structure and function in living things

Answers

Answer:

B.

Explanation: Hope this helps! ^^

1. What is the pH range for an acid?

A. 0 - 7- 14



2. What is the pH range for a base

A. 0 - 7- 14



3. What are the products of an acid base reaction?

A. water and salt

B. acid and base

C. water and sugar

D. water



4. What substance has a neutral pH?

A. ammonia

B. water

C. sodium bicarbonate

D. vinegar



5. The negative ion found in bases is the ______________

A. hydrogen ion (H+)

B. hydroxide ion (OH-)

Answers

Answer:

0-7-14

0-7-12

c is correct water and suger

d is correct vinegar

b is correct (OH-)

When covalent bonds form. the amount of energy present decreases. What happens to the stability of the atoms in the bond?

Answers

Covalent bonding occurs when pairs of electrons are shared by atoms. Atoms will covalently bond with other atoms in order to gain more stability, which is gained by forming a full electron shell. By sharing their outer most (valence) electrons, atoms can fill up their outer electron shell and gain stability.

What are the three main classifications that describe galaxies? By what one visible
characteristic do scientists categorize galaxies?

Answers

Answer:

Spiral Galaxies, Elliptical Galaxies  & Irregular Galaxies

Explanation:

How did galaxies originate? Astronomers believe that after the big bang, the explosion which began the universe 10 billion to 20 billion years ago, gravity began to compress masses of free-floating gas. Two main theories, bottom-up and top-down, explain what happened next. According to bottom-up theories, clusters began to form and assembled together into the larger units we know as galaxies. Top-down theories suggest that galaxies formed first, and the stars and other objects within them were subsequently produced. They categorized different galaxies to maintain their tests from the other galaxies.

MULTIPLE CHOICE QUESTION
Why do scientists think that cuttlefish
have the biggest brain to body ratio of all
invertebrates (animals without a spine)?

Answers

Answer:

Due to its high intelligence.

Explanation:

Scientists think that cuttlefish  have the biggest brain to body ratio of all  invertebrates that allows it to sense sight, smell, and sound that comes to it in the form of pressure waves. Due to this big brain, cuttlefish are very intelligent so due to its intelligence the scientists thinks that cuttlefish has the biggest brain as compared to other big vertebrates such as octopus.

multiple choice
Daytime temperatures on Mercury are extremely hot because:

1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes

Answers

Answer: it has long days

Explanation:

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

If the cell cycle lasts 36 hours and mitosis takes 25% of the cell cycle, how many hours will the cell be in mitosis?

Answers

mitotic index I = (P+M+A+T)/ TOTAL cell, N) *100 %
(P+M+A+T) — the sum of all cells in phase as prophase, metaphase, anaphase and telophase, respectively; N — total number of cells.
Mitototic index (MI) is 3/25000 x 100 = 1.2 %
From the cell cycle, 1.2% is mitotic and the rest will obviously be interphase.
So, 1.2% is 30 minutes, so 100% (length of total cell cyle) is 2500 minutes (42hours).




I hope this helped you.

Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D

Answers

Answer:

C

Explanation:

it has the example figure number 7 and also it has the correct bisector

What environment does ambulocetus live in?

Answers

Answer:

northern Pakistan, in long-lost coastal shallow seas and brackish rivers

Explanation:

i'm hoping this is right

What appearance is liquid and gas? Choose all that apply.
A: Flows
B: Rigid
C: Stays at bottom of the container
D: Holds it's shape
E: Fills container
F: Takes shape of container
G: No visible shape

Answers

Answer:

2 shows the differences among solids, liquids, and gases at the molecular level. A solid has definite volume and shape, a liquid has a definite volume but no definite shape, and a gas has neither a definite volume nor shape

Explanation:

Electron transport from complex I to complex IV pumps more protons than transport from complex II to complex IV.
With this in mind, which will produce more ATP

A. Transport from complex I produces more ATP.

B. Transport from complex II produces more ATP.

C. Both produce the same amount of ATP.

Answers

Answer:

A

Explanation:

ATP synthase uses a proton gradient to make ATP. Since transport from complex I creates a larger proton gradient, it also produces more ATP.

Electron transport from complex I produces more ATP.

ELECTRON TRANSPORT CHAIN:

The electron transport chain, ETC, is the third and last stage of aerobic cellular respiration. It produces the highest molecules of ATP in cellular respiration.

The ETC involves the transfer of electrons to series of molecules in order to create an electrochemical gradient needed for ATP synthesis.

The electron transport chain is made up of four complexes namely: Complex I, II, III and IV. NADH and FADH2 produced in the Krebs cycle are the electron carriers.

Complex I pumps more hydrogen ions (H+) from the mitochondrial matrix to the intermembrane space.

Since the pumped is directly related to the number of ATP molecules, complex I will produce more ATP molecules.

Learn more: https://brainly.com/question/442662?referrer=searchResults

What changes occur to the ratio of surface area to volume as a cell
grows?

Answers

Answer:

As a cell grows, its surface area-to-volume ratio decreases

What process in humans is a good representation of asexual reproduction?

A. Meiosis

B. Mitosis

C.Fertilization

Answers

Answer:

B.

Explanation:

explain how the equilibrium price is determined​

Answers

Answer:

The equilibrium price is the price at which the quantity demanded equals the quantity supplied. It is determined by the intersection of the demand and supply curves. .

A decrease in demand will cause the equilibrium price to fall; quantity supplied will decrease.

Explanation:

The function of mitochondria and chloroplasts is related to energy. In what way does their function differ?
A.
Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells.
B.
Mitochondria produce energy from food, while chloroplasts produce food from the Sun’s energy.
C.
In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green.
D.
Mitochondria provide energy in the night, while chloroplasts provide energy in the day.
E.
Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Answers

Answer:

The answer is option E- Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Explanation:

It’s E the answer is E mitochondria provide energy from food synthesized by organelles other than chloroplasts while chloroplasts provide energy through photosynthesis using the sun’s energy

rko vs claymore who will win​

Answers

Answer:

claymore duh

Explanation:

Answer:

claymore

Explanation:

which of the following is problem created when a cell becomes to large

Answers

Answer:

As a cell increases in size, it usually does not make extra copies of DNA. If a cell became too large, an "information crisis" would occur. The cell has more trouble moving enough nutrients and wastes across the cell membrane.

Explanation:

What is the difference between a molecule and a diagram of a molecule ?

Answers

Answer: The molecule itself is the actual thing present.

while the diagram explains what makes up a molecule or what it looks like structurally

Explanation:

What is a constant?
O a variable
a number that stands alone with no variable
O the number in front of the variable
O two terms that look exactly the same


need help please

Answers

Answer:

a number that stands alone with no variable

Hope this helps!

Other Questions
What was it about Mount Everest that the author found irresistible why dont yall answer my questions In the equation y=4 over 3 x +5 what is the slope and y-intercept What is the value of the growth factor of the function? A) 1/5 B) 1/3C) 2D) 6 Challenge The numbers of home runs a baseball player hits during spring training and during the regular season for four years are shown. Decide if the relationship between home runs hit in spring training and during the regular season is proportional. If the table represents a proportional relationship, find how many home runs are hit during the regular season if the player hit 3 during spring training F(x)=1/2x+4 and g(x)=8f(x). What equation shows the correct rule for the function g? A. g(x)=8x32. B. g(x)=4x+4. C. g(x)=4x32 What would be the concern if a high percentage of cells were in some phase of Mitosis? I need help ASAP with this please bill nye chemical reactions: the picture looks cut off but can someone please help! Which 3 statements are true about journal entries? (Quick Books)(Select all that apply)1.Total debits must equal total credits2.You can post to Products and Services in a journal entry3.When posting to the accounts receivable account, you must specify a vendor4.When posting to the accounts receivable account, you must specify a customer5.You can post to multiple accounts receivable and/or accounts payable accounts in the same journal entry What would you use to determine whether an acid or alkali has been added to a solution?A. ReactantB. IndicatorC. AdjustorD. Identifier PLZ HELP IM BEGGING Please help me I will give you the brain thing and extra points.Two dogs are pulling a disk, but the disk is not moving. The disk does not move because the forces are (select one: unbalanced, balanced, in motion, at rest.) Can someone please help! Its just Area so it should be pretty simple but I am stuck please help! what does jefferson think the government should not do Please help me if you can each unit requires 1.8 yd of fabric to be produced. at the end of each quarter, 20% of the next quarter's production needs for material should be at hand. budgeted purchases of material for the second quarter would be g What is the sum of (4s+3)+(2s+1) A sandbox is located at (-8, -3). How many UNITS apart on the coordinate plane are the locations of the swing set and the sandbox? The Mountain Spring Water Company is moving their backup supply of drinking water to a different site. Each tank weighs according the table shown here. Determine if the function is linear or not. bothneitherlinearnonlinear