Which of the following statements is TRUE about food for animals and
plants

Answers

Answer 1

Answer:

umm

Explanation:


Related Questions

What nitrogen base does Cytosine pair with

Answers

Answer:

Guanine

Explanation:

There are four nitrogenous bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine)

Adenine always bonds with thymine, and cytosine always bonds with guanine.

What type of graph is used for a PH test

Answers

Explain why a line graph is used for the pH data. Line graphs are utilized when data is continuous. It’s either a line graph or bar graph but usually line graph

Which of the following best describes continental drift?
A. There is no evidence that the plates move
B. The plates move about 1 inch per year.
C. The plates move about 30 kilometers per year.
D. It has never happened.​

Answers

Answer:
B- the plates move at about one inch per year

Explanation:

The two continents are moving away from each other at the rate of about 2.5 centimeters (1 inch) per year. Therefore, the plates move about an inch a year!

I hoped this helped my darling!

Tongue rolling is a dominant trait. Explain why it is possible for both parents being able to roll their tongue but their biological child is not able to do so.

Answers

The parents are heterozygous so when they have a kid they got the ressesive trait so they can’t roll there tongue

Answer:

The answer is 0 ( AKA A )

Explanation:

Parents form the same type of gene, which is Rr. Since all the genes are the same, there can not be a chance that the offspring can not roll the tongue. Next time focus on your work!! :3

A one-hectare forest community is sampled in early August. The sample yields 12 small trees, 4 types of vines, as well as 17 native shrubs that represent 10 species. What can be estimated from the sample for the shrubs in the forest community?

A. the forest’s productivity

B. the species richness

C. the degree of forest disturbance

D. the stability of the ecosystem

E. the uniformity of species distribution in the ecosystem

Answers

Answer:

The correct answer is - B. the species richness

Explanation:

Species richness determines the numbers of different species are present in an ecological community. It is a numerical value or count of different species present in a particular community.

The given information or data can only be used to estimate the species richness in the particular forest community as there is data available about the number of species presnt in this community.

I need help with this

Answers

Answer:

what is the name of this website

or the book?

P S Q R The biological levels of organization range from a single organelle all the way up to the biosphere in a highly structured hierarchy. Multicellular organisms are organized from the simplest to most complex: cells, tissues, organs, organ systems, organisms. Evaluate the model above. Select ALL of the statements that accurately depict the examples shown in the model. A) R shows an animal cell. B) O shows types of tissue. P shows organs in the endocrine system. D) P shows an organ system, the digestive system. E) S shows an organ system, the digestive system.​

Answers

Answer: the red thing pretend is blood and blue thing is water you first ta

Explanation:

Answer:

A) R → Q → P → S

Explanation:

I just took the test on USA Test Prep

Consider the following chemical reaction: Hb + O2 → HbO2 When this reaction is going from right to left, what process is occurring?

O a. oxygen unloading

O b. cellular respiration

O c. pulmonary ventilation

O d.oxygen loading

Answers

Answer: A, Oxygen Unloading

15. Cells found in plants and animals have similarities but can differ in function. Consider the following two organisms: a corn plant cell (Zea mays) and a camel cell (Bactrianus ferus). What is the best explanation for the difference in the cellular vacuole size between these two biotic organisms?

A. The corn cells' have a small vacuole size because it does not need long term water and
electrolyte storage.

B. The camel cells' have a small vacuole size because it does not need long term water and electrolyte storage.

C. The camel cells' have a small vacuole size because it is not in contact with toxins that need to be removed from the cell.

D. The corn cells' have a large vacuole size because it is in contact with many toxins in the soil which need to be removed from the cell.

Answers

The best explanation for the difference in the cellular vacuole size is option d. The corn cells' have a large vacuole size.

Explanation to the difference in the cellular vacuole size:

When there is the difference in the vacuole size that lies between the two biotic organism so it is due to the corn cells that contain high vacuole since they are in contact with various toxins in the soil that need to be eliminated from the cell.

hence, the correct option is d.

And, the rest of the options are wrong.

Learn more about cell here: https://brainly.com/question/14568392

How does competition limit the amount of individuals in populations?

Answers

Answer:

Due to competition, many animals starve, many become prey, etc.

Explanation:

Describe how Mendel performed his pea plant experiments.

Answers

Answer:

Every offspring does not look alike they change with the generations

Explanation:

3. In the image, which letter represents the enzyme?
a. Letter A
b. Letter B
c. Letter C
d. Letter D

Answers

Answer: The answer is C

Explanation:

The correct option is, (c) Letter C.

What is the enzyme?Proteins called enzymes assist our bodies' chemical reactions move forward more quickly. For several processes, including digestion and liver function, enzymes are crucial. Health issues might result from having too much or too little of a specific enzyme. Healthcare professionals can also use the enzymes in our blood to look for injuries and illnesses.

How do you classify enzymes?

According to the sort of process they catalyze, enzymes are divided into six categories:

Oxidoreductases. Transferases.Hydrolases.Lyases.Ligases.Isomerases.

What are the 7 enzymes?Depending on the type of reaction they catalyze, enzymes can be divided into seven different types. These groups include hydrolases, lyases, isomerases, ligases, translocases, oxidoreductases, transferases, and hydrolases.

What is enzyme structure?Proteins called enzymes are made up of amino acids connected by one or more polypeptide chains. The fundamental structure of a polypeptide chain refers to this arrangement of amino acids. This in turn dictates the enzyme's three-dimensional structure, including the active site's shape.

Learn more about enzyme here:

https://brainly.com/question/1596855

#SPJ2

Why are water and sunlight two abiotic factors that are important to most organisms?

Answers

All organisms need water to survive and plants/algae need sunlight to make food in photosynthesis. ... Organism, Population, Community and Ecosystem.

HOPE THIS HELPS

help please 30 points will give brainliest
Plants release the waste ___________ during cellular respiration and ____________ during photosynthesis.

fill in the blanks

Answers

Plants release the waste carbon dioxide during cellular respiration and oxygen during photosynthesis.

In the 1860s Gregor Mendel performed numerous dihybrid crosses between pea plants. Dihybrid crosses involve the study of the inheritance patterns related to two different traits. In guinea pigs the allele for black fur (B) is dominant over the allele for brown fur (b), and the allele for short fur (F) is dominant over the allele for long fur (f). What percentage of the offspring from a BbFf x bbff cross would be expected to be heterozygous for both traits

Answers

Answer:

25% of the progeny is expected to be dihybrid, BbFf, expressing Black and short fur

Explanation:

Available data:

the allele for black fur (B) is dominant over the allele for brown fur (b)the allele for short fur (F) is dominant over the allele for long fur (f)Cross: BbFf x bbff

Parentals)            BbFf      x         bbff

Phenotypes) Black/Short    Brown/Long

Gametes)       BF, Bf, bF, bf      bf, bf, bf, bf

Punnett square)      BF         Bf          bF          bf

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

F1) 4/16 = 1/4 = 25% of the progeny is expected to be dihybrid, BbFf, expressing Black and short fur

    4/16 = 1/4 = 25% of the progeny is expected to be bbFf, expressing Brown and short fur

    4/16 = 1/4 = 25% of the progeny is expected to be Bbff, expressing Black and long fur

    4/16 = 1/4 = 25% of the progeny is expected to be bbff, expressing Brown and Long fur

Answer:

25%

Explanation:

Because i took the test

predict if a coelomate or an acoelmate would be larger

Answers

Answer:

Explanation:

A coelom is a hollow space surrounded by tissues. The basic structure of most animals comprises three tissue layers, an interior endoderm and an exterior ectoderm that are separated by a mesoderm. Typically, the endoderm forms the innermost digestive tract, the ectoderm the outermost skin layer, and the remaining internal organs are formed from the mesoderm. In derived animals, the endodermal tube is suspended from the dorsal and ventral surfaces by mesoderm, so as to leave open coeloms that allow circulation of fluids. Advanced circulatory systems develop from these coeloms.

5 5. Normally, the temperature inside the scrotum is slightly lower than normal body temperature. What do you predict would happen if the temperature inside the scrotum were a few degrees higher than normal body temperature instead? A. Sperm would not be able to travel through the vas deferens. B. Sperm would be stored in the epididymis rather than in the testes. c. Sperm would not be able to develop properly. D. The rate of sperm production would increase,​

Answers

Answer:

C. Sperm would not be able to develop properly.

Explanation:

There is an optimum temperature where sperm production is at its best. An increase or decrease in temperature may affect the quality and quantity of the sperm.

If the temperature inside the "sc-rotum" raises by few degree than normal body temperature, than the "sp-erm" would not be able to develop properly.

What is the function of "sc-rotum"?

A pouch, which is suspended from the groin, and comprising the "tes-tes" and some of the male "s-ex" accessory ducts is known as the "sc-rotum". The prime function of the "sc-rotum" is to maintain the temperature essential for the process of "sper-matogenesis", that is, by situating the testes external of the body cavity.

Within the human "sc-rotum", the temperature is 3.1 degree C lesser than the usual temperature of the body. In case, if the temperature elevates of the "sc-rotum", the degeneration of the germinal epithelium will take place, which will eventually result in sterility. Therefore, for the production of sperms within the testes, a lower temperature is needed, otherwise the development of the "sp-erm" will not take place appropriately.

Thus, the correct answer is option C.

Find out more information about the function of "sc-rotum" here:

https://brainly.com/question/940283

which are examples of steroids? A. testosterone and trans fats B. cholesterol and phospholipids C. cholesterol and vitamin D D. estrogen and phospholipids

Answers

Answer:

A

Explanation:

because it really is suppose. to make u more stronger tougher and high testosterone.

Describe some of the changes in the land and in life-forms that occurred at the end of the Paleozoic Era.

Answers

during the end of the paleozoic era it was probably one of the greatest mass extinctions on earth and the land started to break up and move around to form what the world looks like today

Please help ASAP!!!
In the formation of pollen grains, the nucleus in the pollen will divide by mitosis to form two nuclei. Justify.​

Answers

Answer:

The other two, the generative nuclei, can be thought of as non motile sperm cells. After reaching an ovule and breaking out of the pollen tube tip, one generative nucleus unites with the egg cell to form a diploid zygote.

Explanation:

This means that;

The fertilized egg with two complete sets of chromosomes, one from each parent. The zygote undergoes a limited number of divisions and gives rise to an embryo.

The average number of individuals of the same species per unit of area or volume at a given time is the
population's
O carrying capacity,
O birth rate.
O size.
Odensity.
O distribution.
Next >

Answers

Huhhhhhhhhhhhhhhhhhhhhhhhh

What are Tectonic Plates made of and what do they do?

Answers

Answer:

They move

Explanation:

Answer:

A tectonic plate (also called lithospheric plate) is a massive, irregularly shaped slab of solid rock, generally composed of both continental and oceanic lithosphere.Plate tectonics move because they are carried along by convection currents in the upper mantle of the planet (the mantle is a slowly flowing layer of rock just below Earth's crust). Hot rock just below the surface rises and when it cools and gets heavy, it sinks again.

Explanation:

The shark still has identical skeleton to previous sharks. What other way can you prove evolution occurred if fossil evidence does not show any?

Answers

There is biogeography comparative and anatomy and comparative embryology and molecular biology

Help!!
Cells of the skeletal system are specialized in their structure to store minerals. Which of the following is the function of these cells?

Produce chemicals that transmit signals.

Prevent the spread of disease in the organism.

Provide support to the body.

Absorb excess water released by digestion.

Answers

Answer: Provide support to the body.

Explanation:

The skeletal system is a system which is formed by the bones. The bones are important for the structure and function of the body. The bones are connected with the muscles to allow the movement of the body, and they protect the vital organs like heart, lungs, brains, and others. They provide support to the soft tissues, organs, and muscles of the body. They keep the human body upright. The skeletal system provide shape to the body. It provides support by acting as regions of attachment of soft body parts and muscles.

Explain why only certain substrate can combine with enzymes.
Help me please​

Answers

Answer:

sry i cant i too dubm need points tho

Explanation:

Many closely related species of ducks have different courtship dances that are performed to solidify a pair-bond. If you were to cross individuals from each of these species what would you expect to see in the hybrid offspring if behaviors related to pair-bond formation were completely due to genetics?

Answers

Answer:

I would expect to see a new phenotype in which the new duck hybrid species would express a new mixed courtship dance with the behaviors of both parentals.  

Explanation:

The cross between both parentals, each from different species, might produce a new phenotype that exhibits both parental dances. The new dance might be considered a hybrid of the parental dances.

Genetically speaking, we can think that there is a gene codifying for the courtship behavior in one species and another gene expressing a different courtship behavior in the other species. This cross´ product would be a hybrid species that exhibits a part of both parentals´ behaviors.

What is the range for the following set of measurements?
3.1 mL, 2.7 mL, 4.6 mL, 1.9 mL, 8,7 mL

Answers

The range of the set is 6.8,
because 8.7-1.9=6.8

Lungs, Trachea, Diaphragm, Nose: Which organ system do these belong to?
Circulatory
Excretory
Digestive
Musculoskeletal
Respiratory

Answers

Answer:

Respiratory

Explanation:

they all come together and help with breathing and oxygen :)

Answer: respiratory system

Explanation:

The behavior of an organism is influenced by both internal and external factors. How might a bear be influenced by external factors in its environment? A. A decrease in the number of fish causes bears to start consuming more plants. B. An increase in hunting causes bears to stay in covered areas and avoid humans. C. A decrease in temperature causes bears to look for food during the day instead of at night. D. all of these

Answers

Answer:

D. all of these

Explanation:

I just got it right in study island (:

Answer:

it's D

Explanation:

Determine the mRNA and amino acid sequence for the below DNA sequence.

Answers

AUGAGCCCCGCUAGGUUCUC
Other Questions
Ive tried this many times and I cant figure it out. Will give brainliest. Vaughn, Inc. had net sales in 2020 of $1,410,300. At December 31, 2020, before adjusting entries, the balances in selected accounts were Accounts Receivable $348,200 debit, and Allowance for Doubtful Accounts $2,940 credit. If Vaughn estimates that 10% of its receivables will prove to be uncollectible. Prepare the December 31, 2020, journal entry to record bad debt expense. Solve X[tex] {16}^{ \frac{1}{5} } \times {2}^{x} = {8}^{ \frac{3}{4} } [/tex]I got X= 9/10am I right? Help. I have no idea what to do thesis: physical science improves nursing through technology, energy, and Matter. write a 4-page essay explaining how science improves Nursing career and how it revolves around TechnologyEnergy Matter three numbers are in A.P. the difference between the first and the last is 8 and the product of these two is 20. find the numbers List two kinds of text structure what is 1/12 in simplest form Find mZECDEDC 31ABPLEASE HELP I WILL GIVE BRAINLIEST what does it mean to be purebread ? Estimate the radius of the object 20 points!!!Write a two stanza, eight-line poem in blank verse form that includes at least one use of enjambment. The verse does not necessarily need to be in iambic pentameter. It must, however, keep a consistent meter across all eight lines. Unit 2 Quiz10) Renee and Daniel, who are currently both working full-time jobs, are preparing for Daniels mother to move in. As his mother will require a great deal of care, they are trying to decide if they are both going to keep working. What benefit will they MOST LIKELY experience if they choose a single-income option?A. They will have more disposable income.B. They will have a greater amount of financial income.C. They will have more time to manage his mother's care.D. They will have less time to spend with their new baby. what is the area of the conposite figure? If emergency vehicles are responding to an emergency, you need to By the end of June, how were Confederate troops surviving?no tiny links Purchase Transactions and T AccountsUsing T accounts for Cash, Accounts Payable, Purchases, Purchases Returns and Allowances, Purchases Discounts, and Freight-In, enter the following purchase transactions. Identify each transaction with its corresponding letter. Post the transactions in the given order.Purchase of merchandise with cash.a. Merchandise is purchased for cash, $1,500.b. Merchandise listed at $3,500, less a trade discount of 15%, is purchased for cash. A baby carriage is sitting at the top of a hill that is 21 m high. The carriage with the baby weighs 20kg. The carriage hasenergy. Calculate it What is one characteristic that all Tall Tales share?MonologueForeshadowingExaggerationMystery Write a jingle to advertisefavorite dessert to the tune of"Twinkle, Twinkle Little Star."What is so special about thisdessert? How can you describe itin a memorable, catchy way?Yall someone help no link ,will be reported