Answer: depending on viscosity, mass and velocity of impact, if droplet integrity is maintained, as velocity increases, diameter will increase from
Approximately d*sqrt(2) to 2*sqrt(d^3/6a) where d is original diameter and a is thickness when the droplet flattens into a disc.
Explanation:
This applies generally to any liquid droplet, which by inference falls and impacts a solid surface. The impact force is mgh where m= mass, g= acceleration due to gravity, h= initial height.
A liquid droplet deforms on impact. Assume the drop is sperical, then the deformation distance, d= diameter of the droplet then the average impact force = mgh/d.
The droplet may spread, splash or bounce, depending on viscosity and force, which depends on mass and velocity immediately before impact.
All than can be said is that if the droplet maintains integrity it could achieve the shape of half a highly flattened oblate spheroid. Approximating this with a flattened disc of thickness a, and an original volume of 4/3pi(d/2)^3, the volume as a disc =a*pi*r^2 so the horizontal diameter = 2*sqrt(d^3/6a)
It is not really possible from the available data to determine whether the droplet would remain its integrity, but at sufficiently low force/velocity, the droplet could retain a near-hemispherical shape, giving a horizontal diameter of the hemisphere = d*sqrt(2)
As velocity increases, if integrity is maintained, the diameter will increase from the second approximation to the first
Lister cultured the bacteria responsible for milk spoilage.
True
False
Answer:
True
Explanation:
A large bowl contains a mixture of soil and iron powder. What would be the best way to separate the iron powder from the soil?
Answer:
Add magnet to the bowl, cover the bowl, and shake well
Explanation:
Anything with MAGNET
the combination of a heart arteries and veins and capillaries is____
Answer:
A (an organ system)
Explanation:
which wall structures are found in plant cells but not in animal cells check all that apply
cell wall
cell membrane
endoplasmic reticulum
nucleus
chloroplasts
mitochondria
Answer:
cell wall, chloroplasts
Explanation:
no explanation, just the correct answer
Answer:
Options: A and E
Explanation:It was correct on edg 2021, Have a blessed day.
Clever ones this is one for you
If you throw a pebble into a pond, ripples spread out from where it went in. These ripples are waves travelling through the water. The waves move with a transverse motion. The undulations (up and down movement) are at 90° to the direction of travel.
Answer:
so please Indicate your question
In organisms other than plants, when and where is the most ATP produced?
in cytoplasm, during photosynthesis
in nuclei, during cellular respiration
in chloroplasts, during photosynthesis
in mitochondria, during cellular respiration
Answer:
D. In mitochondria, during cellular respiration.
Explanation:
A cell can be defined as the fundamental or basic functional, structural and smallest unit of life for all living organisms. Some living organisms are unicellular while others are multicellular in nature. A unicellular organism refers to a living organism that possess a single-cell while a multicellular organism has many (multiple) cells.
All living organisms such as plants and animals require energy to function properly (life activities). Thus, the organelle where energy from nutrients is released is generally referred to as mitochondria. Animals retrieve energy using mitochondria to do cellular respiration because they typically act like a digestive system by taking in nutrients, breaking them down and obtaining energy rich molecules for cell-life activities.
Cellular respiration can be defined as a series of metabolic reactions that typically occur in cells so as to produce energy in the form of adenosine triphosphate (ATP). During cellular respiration, high energy intermediates are created that can then be oxidized to make adenosine triphosphate (ATP). Therefore, the intermediary products are produced at the glycolysis and citric acid cycle stage.
Basically, mitochondria is one of the cell organelles found in all living organisms and it is known as the powerhouse. Therefore, mitochondria provides all the energy required in the cell by transforming energy forms through series of chemical reactions; breaking down of glucose into Adenosine Triphosphate (ATP) used for providing energy for cellular activities in the body of living organisms.
In organisms other than plants, the most ATP is produced in mitochondria, during cellular respiration.
Answer:
D
Explanation:
got it right on edge
What might be the consequences of your choice?
• Political:
• Economic:
• Social:
Answer:
Political: Lobbyists.
Economic:Farmers and industrial companies will significantly reduce their output and reduce local jobs. The companies that sell pesticides and fertilizers to local companies will also suffer losses. Farmers will suffer the most if they are unable to find safer fertilizers and pesticides to use.
Social:After a period of time, water pollutants will reduce to safe levels. This could be a long wait. Poverty may increase in the region due to lost jobs and income.
Explanation:
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
Answer:
I don't know the answer
Explanation:
is is this even a question cos I don't think so.
Please I need Help!!
● Prophase I
● Metaphase I
● Anaphase I
● Telophase I
● Prophase II
● Metaphase II
● Anaphase II
● Telophase II
Answer:
Its in this order: 3 - 4 - 1 - 6 - 5 - 7 - 2 - 8
Explanation:
I learned this a while ago so I would know
Skim the headings and bold words in this section. Write four steps scientists might take to solve a problem.
Answer:
1) Create a hypothisis 2) Create experiment 3) collect data 4) write conclusion
The four steps that a scientist uses to solve a problem are creating hypothesis, experiment, data sorting and writing conclusion.
What are hypothesis?A hypothesis is an elaboration posited for a characteristic. The scientific technique requires that a hypothesis be testable in order for it to be considered a scientific hypothesis.
Scientists typically base scientific hypotheses on previous findings that cannot be adequately explained by existing scientific theories.
Any process that co-ordinate system data into some defined order to make it simpler to understand, analyze, or visualize is referred to as data sorting.
The conclusion is the final section of an academic essay. The conclusion should restate your response to the question and briefly summarize key points. It does not contain any new points or information.
A scientist solves a problem by developing a hypothesis, conducting an experiment, sorting data, and writing a conclusion.
Thus, by using these steps, scientist can come to an end for the problem.
For more details regarding hypothesis, visit:
https://brainly.com/question/17173491
#SPJ2
plz help me i beg of you!???
Answer:
Pretty sure it's D, because the birds beak evolves to crush those grains as a result of certain food available in their habitat, although it does not say "diet" as an option so D is your best guess.
Explanation:
And, what else it literally says CHECK ALL THAT APPLY like....
Answer:
i dont understand??????
Explanation:
Answer:
What??
Explanation:
This makes no sense to me...
a sedimentary rock formed from clay deposits
Answer:
is it shale
sorry if that's not right it's kinda confusing how you put the question
Explanation:
Please help I will give a brainliest
Answer:
answer
Explanation:
im not that good w these sorry
Artificial selection applies only to dog breeding?
True OR False.
Answer:
Domestication is the act of separating a small group of organisms (wolves, in this case) from the main population, and select for their desired traits through breeding. ... Dog breeding is a perfect example of how humans select for desirable or fashionable traits.
true...?
Explanation:
Answer:
False.
Explanation:
The bananas we have today were created using artificial selection. Same thing with peanuts by the way.
What boundary is present at the Philippine plate and the Eurasian plate?
A convergent boundary resulting in earthquakes and volcanic activity
B transform boundary resulting in fault lines and shallow earthquakes
C divergent boundary resulting in mid-ocean ridge and creation of new sea floor
D convergent boundary resulting in mid-ocean ridge and widening of ocean basic
Answer:
D
Explanation:
Help me now please!!!!!!!!
Desert plants and animals are adapted to the lack of what and high
Answer:
lack of water and high concentration of heat and dryness
Explanation:
Deserts don't get that much rainfall, so desert wildlife are adapted to survive in such a dry climate. Take the camel, for instance, it can store three bathtubs of water in it's hump, so it can go a very long time without water. And without that rainfall, the desert is dry and, usually, very hot. Animals have adapted to this by only coming out in the nighttime when it's cooler.
hope this helped:)
what animal kingdoms were divided
Answer:
The scheme most often used currently divides all living organisms into five kingdoms: Monera (bacteria), Protista, Fungi, Plantae, and Animalia. This coexisted with a scheme dividing life into two main divisions: the Prokaryotae (bacteria, etc.) and the Eukaryotae (animals, plants, fungi, and protists).
PLZ ASAP
A scientist is using a microscope to observe a type of
bacteria.
Which two structures would the scientist most likely see?PLEASE EXPLAIN WHY
A:nucleus and DNA
B:DNA and cell wall
C:cell wall and vacuole
D:vacuole and nucleus
Answer:
The two structures most likely to be observed by the scientist when looking at a type of bacteria under the microscope are cell wall and vacuole (option C).
Explanation:
Bacteria are prokaryotic organisms that lack a nucleus, most of the organelles, and whose DNA is dispersed in the cytoplasm. Some types of bacteria have a plasma membrane surrounded by a cell wall, and may be equipped with vacuoles to perform their functions.
It is very likely that two structures that are most likely to be differentiated when a type of bacteria is observed under the microscope are the cell wall and the vacuole, according with information above.
The other options are not correct because:
A and D. Bacteria lack a nucleus.
A and B. Bacterial DNA is dispersed in the cytoplasm and is very difficult to observe under the microscope.
Answer:
cell wall vacuole
Explanation:
An organism is currently using light energy to make food. Based on what you have learned, this organism will be best classified as
Answer:
This organism is best classified as an autotroph.
Explanation:
Autotrophs can make their own food.
Is a seed a living organism
Answer:
Yes they are living organisms
I need help. Due today.
Answer:
D) common ancestry among vertebrate species
What is the independent variable?
What is the dependent variable?
Answer:
the independent is the age of the tree and the dependent is the diameter
Explanation:
the diamter of the tree is based off of the age as we can see that it gets bigger the older the tree is
Answer: Independent variable: age of the tree (years), Dependent variable: tree diameter (mm)
The diameter of the tree is dependent on what age the tree is. As the tree gets older, the diameter increases. The dependent variable depends/relies on the value(s) of the independent variable.
During a period of drought, members of a community may volunteer to water their lawns every other day, rather than daily. The most important benefit of this action is - It adds nitrogen to the soil It fertilizes the soil It reduces air pollution It conserves the groundwater supply
Answer:
hi love you have a nice day
Explanation:
PLEASE HELP I WILL MARK BRAINLIEST. Listed in the Item bank are key terms and expressions, each of which is associated with one of the columns. Some terms may display additional information when you click on them. Drag and drop each item into correct column. Order does not matter. PLEASE HELP
Producer: Grass, trees, algae
Consumer: Birds, cows, humans
Decomposer: Earthworms, fungi, mushrooms
Answer:
Producer: Grass, trees, algae
Consumer: Birds, cows, humans
Decomposer: Earthworms, fungi, mushrooms
Explanation:
Hope This Helps!
Please Mark Me Brainly!
An idea in science is supported or rejected after several
Question 23 options:
publications
experiments
alterations
meetings
Answer:
experiments
Explanation:
Answer:
experiments
Explanation:
I took the test
Pls help :)) worth 10 points (:
Answer:
A
Explanation:
just go for A
I Will Give BRIANIEST
A scientist tests the water in a local pond and finds that it has a pH of 7.9.
What is true about the water sample?
Choose 1 answer:
(Choice A)
A
It is basic.
(Choice B)
B
It is acidic.
(Choice C)
C
It is neutral.
(Choice D)
D
It is both basic and acidic.
Answer:
it is Basic brooooooo. No B NOT C AND NOT D. oNly A
The answer is A. The ph of regular water is about 7.0 or so. so since it's 7.9 it means it's basic. You're welcome :)
When is carbon dioxide used during photosynthesis?
A. Light- independent reaction
B. Light-dependent reaction
C. Carbon dioxide is made, not used
Answer:
Pretty sure its b.
Explanation: