6. In general, as both the force and velocity of impact increase, what happens to the diameter of
the resulting blood droplets?

Answers

Answer 1

Answer: depending on viscosity, mass and velocity of impact, if droplet integrity is maintained, as velocity increases, diameter will increase from

Approximately d*sqrt(2) to 2*sqrt(d^3/6a) where d is original diameter and a is thickness when the droplet flattens into a disc.

Explanation:

This applies generally to any liquid droplet, which by inference falls and impacts a solid surface. The impact force is mgh where m= mass, g= acceleration due to gravity, h= initial height.

A liquid droplet deforms on impact. Assume the drop is sperical, then the deformation distance, d= diameter of the droplet then the average impact force = mgh/d.

The droplet may spread, splash or bounce, depending on viscosity and force, which depends on mass and velocity immediately before impact.

All than can be said is that if the droplet maintains integrity it could achieve the shape of half a highly flattened oblate spheroid. Approximating this with a flattened disc of thickness a, and an original volume of 4/3pi(d/2)^3, the volume as a disc =a*pi*r^2 so the horizontal diameter = 2*sqrt(d^3/6a)

It is not really possible from the available data to determine whether the droplet would remain its integrity, but at sufficiently low force/velocity, the droplet could retain a near-hemispherical shape, giving a horizontal diameter of the hemisphere = d*sqrt(2)

As velocity increases, if integrity is maintained, the diameter will increase from the second approximation to the first


Related Questions

Lister cultured the bacteria responsible for milk spoilage.
True
False

Answers

Answer:

True

Explanation:

A large bowl contains a mixture of soil and iron powder. What would be the best way to separate the iron powder from the soil?​

Answers

Answer:

Add magnet to the bowl, cover the bowl, and shake well

Explanation:

Anything with MAGNET

the combination of a heart arteries and veins and capillaries is____​

Answers

Answer:

A (an organ system)

Explanation:

which wall structures are found in plant cells but not in animal cells check all that apply
cell wall
cell membrane
endoplasmic reticulum
nucleus
chloroplasts
mitochondria​

Answers

Answer:

cell wall, chloroplasts

Explanation:

no explanation, just the correct answer

Answer:

Options: A and E

Explanation:It was correct on edg 2021, Have a blessed day.

Clever ones this is one for you

If you throw a pebble into a pond, ripples spread out from where it went in. These ripples are waves travelling through the water. The waves move with a transverse motion. The undulations (up and down movement) are at 90° to the direction of travel.​

Answers

Answer:

so please Indicate your question

In organisms other than plants, when and where is the most ATP produced?
in cytoplasm, during photosynthesis
in nuclei, during cellular respiration
in chloroplasts, during photosynthesis
in mitochondria, during cellular respiration

Answers

Answer:

D. In mitochondria, during cellular respiration.

Explanation:

A cell can be defined as the fundamental or basic functional, structural and smallest unit of life for all living organisms. Some living organisms are unicellular while others are multicellular in nature. A unicellular organism refers to a living organism that possess a single-cell while a multicellular organism has many (multiple) cells.

All living organisms such as plants and animals require energy to function properly (life activities). Thus, the organelle where energy from nutrients is released is generally referred to as mitochondria. Animals retrieve energy using mitochondria to do cellular respiration because they typically act like a digestive system by taking in nutrients, breaking them down and obtaining energy rich molecules for cell-life activities.

Cellular respiration can be defined as a series of metabolic reactions that typically occur in cells so as to produce energy in the form of adenosine triphosphate (ATP). During cellular respiration, high energy intermediates are created that can then be oxidized to make adenosine triphosphate (ATP). Therefore, the intermediary products are produced at the glycolysis and citric acid cycle stage.

Basically, mitochondria is one of the cell organelles found in all living organisms and it is known as the powerhouse. Therefore, mitochondria provides all the energy required in the cell by transforming energy forms through series of chemical reactions; breaking down of glucose into Adenosine Triphosphate (ATP) used for providing energy for cellular activities in the body of living organisms.

In organisms other than plants, the most ATP is produced in mitochondria, during cellular respiration.

Answer:

D

Explanation:

got it right on edge

What might be the consequences of your choice?
• Political:
• Economic:
• Social:

Answers

Answer:

Political: Lobbyists.

Economic:Farmers and industrial companies will significantly reduce their output and reduce local jobs. The companies that sell pesticides and fertilizers to local companies will also suffer losses. Farmers will suffer the most if they are unable to find safer fertilizers and pesticides to use.

Social:After a period of time, water pollutants will reduce to safe levels. This could be a long wait. Poverty may increase in the region due to lost jobs and income.

Explanation:

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Answers

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

Please I need Help!!
● Prophase I
● Metaphase I
● Anaphase I
● Telophase I
● Prophase II
● Metaphase II
● Anaphase II
● Telophase II

Answers

Answer:

Its in this order: 3 - 4 - 1 - 6 - 5 - 7 - 2 - 8

Explanation:

I learned this a while ago so I would know

Skim the headings and bold words in this section. Write four steps scientists might take to solve a problem.

Answers

Answer:

1) Create a hypothisis 2) Create experiment 3) collect data 4) write conclusion

The four steps that a scientist uses to solve a problem are creating hypothesis, experiment, data sorting and writing conclusion.

What are hypothesis?

A hypothesis is an elaboration posited for a characteristic. The scientific technique requires that a hypothesis be testable in order for it to be considered a scientific hypothesis.

Scientists typically base scientific hypotheses on previous findings that cannot be adequately explained by existing scientific theories.

Any process that co-ordinate system data into some defined order to make it simpler to understand, analyze, or visualize is referred to as data sorting.

The conclusion is the final section of an academic essay. The conclusion should restate your response to the question and briefly summarize key points. It does not contain any new points or information.

A scientist solves a problem by developing a hypothesis, conducting an experiment, sorting data, and writing a conclusion.

Thus, by using these steps, scientist can come to an end for the problem.

For more details regarding hypothesis, visit:

https://brainly.com/question/17173491

#SPJ2

plz help me i beg of you!???

Answers

Answer:

Pretty sure it's D, because the birds beak evolves to crush those grains as a result of certain food available in their habitat, although it does not say "diet" as an option so D is your best guess.

Explanation:

And, what else it literally says CHECK ALL THAT APPLY like....

Answers

Answer:

i dont understand??????

Explanation:

Answer:

What??

Explanation:

This makes no sense to me...

a sedimentary rock formed from clay deposits

Answers

Answer:

is it shale

sorry if that's not right it's kinda confusing how you put the question

Explanation:

Please help I will give a brainliest

Answers

Answer:

answer

Explanation:

im not that good w these sorry

Artificial selection applies only to dog breeding?

True OR False.

Answers

Answer:

Domestication is the act of separating a small group of organisms (wolves, in this case) from the main population, and select for their desired traits through breeding. ... Dog breeding is a perfect example of how humans select for desirable or fashionable traits.

true...?

Explanation:

Answer:

False.

Explanation:

The bananas we have today were created using artificial selection. Same thing with peanuts by the way.

What boundary is present at the Philippine plate and the Eurasian plate?
A convergent boundary resulting in earthquakes and volcanic activity
B transform boundary resulting in fault lines and shallow earthquakes
C divergent boundary resulting in mid-ocean ridge and creation of new sea floor
D convergent boundary resulting in mid-ocean ridge and widening of ocean basic

Answers

Answer:

D

Explanation:

Help me now please!!!!!!!!

Answers

The answer is a can I have brainly

Desert plants and animals are adapted to the lack of what and high

Answers

The two main adaptations that desert animals must make are how to deal with lack of water and how to deal with extremes in temperature. Many desert animals avoid the heat of the desert by simply staying out of it as much as possible

Answer:

lack of water and high concentration of heat and dryness

Explanation:

Deserts don't get that much rainfall, so desert wildlife are adapted to survive in such a dry climate. Take the camel, for instance, it can store three bathtubs of water in it's hump, so it can go a very long time without water. And without that rainfall, the desert is dry and, usually, very hot. Animals have adapted to this by only coming out in the nighttime when it's cooler.

hope this helped:)

what animal kingdoms were divided

Answers

Answer:

The scheme most often used currently divides all living organisms into five kingdoms: Monera (bacteria), Protista, Fungi, Plantae, and Animalia. This coexisted with a scheme dividing life into two main divisions: the Prokaryotae (bacteria, etc.) and the Eukaryotae (animals, plants, fungi, and protists).

PLZ ASAP
A scientist is using a microscope to observe a type of
bacteria.

Which two structures would the scientist most likely see?PLEASE EXPLAIN WHY

A:nucleus and DNA
B:DNA and cell wall
C:cell wall and vacuole
D:vacuole and nucleus

Answers

Answer:

The two structures most likely to be observed by the scientist when looking at a type of bacteria under the microscope are cell wall and vacuole (option C).

Explanation:

Bacteria are prokaryotic organisms that lack a nucleus, most of the organelles, and whose DNA is dispersed in the cytoplasm. Some types of bacteria have a plasma membrane surrounded by a cell wall, and may be equipped with vacuoles to perform their functions.

It is very likely that two structures that are most likely to be differentiated when a type of bacteria is observed under the microscope are the cell wall and the vacuole, according with information above.

The other options are not correct because:

    A and D. Bacteria lack a nucleus.

    A and B. Bacterial DNA is dispersed in the cytoplasm and is very difficult to observe under the microscope.

Answer:

cell wall vacuole

Explanation:

An organism is currently using light energy to make food. Based on what you have learned, this organism will be best classified as

Answers

Answer:

This organism is best classified as an autotroph.

Explanation:

Autotrophs can make their own food.

Is a seed a living organism

Answers

Answer:

Yes they are living organisms

I need help. Due today.

Answers

Answer:

D) common ancestry among vertebrate species

What is the independent variable?

What is the dependent variable?

Answers

Answer:

the independent is the age of the tree and the dependent is the diameter

Explanation:

the diamter of the tree is based off of the age as we can see that it gets bigger the older the tree is

Answer: Independent variable: age of the tree (years), Dependent variable: tree diameter (mm)

The diameter of the tree is dependent on what age the tree is. As the tree gets older, the diameter increases. The dependent variable depends/relies on the value(s) of the independent variable.

During a period of drought, members of a community may volunteer to water their lawns every other day, rather than daily. The most important benefit of this action is - It adds nitrogen to the soil It fertilizes the soil It reduces air pollution It conserves the groundwater supply​

Answers

Answer:

hi love you have a nice day      

Explanation:

PLEASE HELP I WILL MARK BRAINLIEST. Listed in the Item bank are key terms and expressions, each of which is associated with one of the columns. Some terms may display additional information when you click on them. Drag and drop each item into correct column. Order does not matter. PLEASE HELP

Answers

Producer: Grass, trees, algae

Consumer: Birds, cows, humans

Decomposer: Earthworms, fungi, mushrooms

Answer:

Producer: Grass, trees, algae

Consumer: Birds, cows, humans

Decomposer: Earthworms, fungi, mushrooms

Explanation:

Hope This Helps!

Please Mark Me Brainly!

An idea in science is supported or rejected after several

Question 23 options:

publications

experiments

alterations

meetings

Answers

Answer:

experiments

Explanation:

Answer:

experiments

Explanation:

I took the test

Pls help :)) worth 10 points (:

Answers

Answer:

A

Explanation:

just go for A

I Will Give BRIANIEST
A scientist tests the water in a local pond and finds that it has a pH of 7.9.

What is true about the water sample?

Choose 1 answer:


(Choice A)
A
It is basic.


(Choice B)
B
It is acidic.


(Choice C)
C
It is neutral.


(Choice D)
D
It is both basic and acidic.

Answers

Answer:

it is Basic brooooooo. No B NOT C AND NOT D. oNly A

The answer is A. The ph of regular water is about 7.0 or so. so since it's 7.9 it means it's basic. You're welcome :)

When is carbon dioxide used during photosynthesis?
A. Light- independent reaction
B. Light-dependent reaction
C. Carbon dioxide is made, not used

Answers

Answer:

Pretty sure its b.

Explanation:

Other Questions
If purchased before the game, tickets to a high school baseball game cost $1.00. If purchased at the gate, the tickets cost $1.50. For a particular game, 500 tickets were sold and the total receipts were $587.50. How many tickets were purchased before the game and how many tickets were purchased at the gate? how many feet is 1000 km? how is north china and south china's geography different Right=20 points and I'll answer one of urs Which climate has subclimates with humid summers as well as subclimates with long, bitterly cold winters? polar tropical rainy temperate marine temperate continental HELPPP!!!Evaluate the expression. In order for a voluntary exchange to take place,O the buyer has to feel that he or she will be better off after the transaction than before.O the seller has to feel that he or she will be better off after the transaction than before.O both parties must feel that the money or goods they receive is worth more to them than the money or goods they give up. Explain the process by which the Industrial Revolution spread to one country in Europe other than Great Britain. I will mark brainlist for this. If 7 workers take 500 hours to finish a project, how long will it take 14 workers to complete the same project? HELP "Fill in the blanks in the following sentences with the conditional mood of the verbs in parentheses."-Este verano, me (gustar) ir de vacaciones a un lugar clido. Si pudiera, (ir) a Marruecos. All, (visitar) Casablanca y Marrakesh y (tomar) t a la menta. Tambin, (explorar) el desierto y (montar) en camello. Y Juana, t qu (hacer)? (querer) t venir conmigo? Las dos juntas lo (pasar) muy bien y (volver) muy bronceadas! Please help due soon PLEASE HELP!! WHAT IS x??? CAN SOMEONE HELP ME ASAP THISS IS DUE AT 11:59 tonight How does paragraph 15 contribute to the authors central ideas in The Rome Republic? 7=56 pls answer this q fast Which statement describes a series of transformations that would show that Figure A is congruent to Figure B?A. Figure A is reflected over line m and translated 4 spaces to the right.B. Figure A is reflected over line m and translated 7 spaces to the right.C. Figure A is reflected over line k and translated 8 spaces down.O D. Figure A is translated 4 units down and 4 units to the right.E. Figure A is translated 8 units down and 7 units to the right. Which two statements explain why the Mongols were such good warriors? 50 POINTS.!!!!!!!!!!!!In this excerpt from Narrative of Sojourner Truth, which conflict occurs? She had not been there long before her old master, Dumont, appeared, as she had anticipated; for when she took French leave of him, she resolved not to go too far from him, and not put him to as much trouble in looking her up for the latter he was sure to do- as Tom and Jack had done when they ran away from him, a short time before. This was very considerate in her, to say he least, and a proof that 'like begets like. He had often considered her feelings, though not always, and she was equally considerate. When her master saw her, he said, 'Well, Bell, so you've run away from me.' 'No, I did not run away I walked away by day-light, and all because you had promised me a year of my time.' His reply was, 'You must go back with me.' Her decisive answer was, "No, I won't go back with you . Bell is in conflict with Tom and Jack over running away B. Bell is in conflict with nature over the daylight O C. Bell is in conflict with French society over slavery D. Bell is in conflict with Dumont over her enslavement What is the solution to 6x42(x4) ?x3x3x2x1