Between which two consecutive integers is the

fraction 29/7?

A.2 and 3

B. 3 and 4

C. 4 and 5

D. 5 and 6

Answers

Answer 1

Answer:

C. 4 and 5

Step-by-step explanation:

29/7 = 4 1/7


Related Questions

Need help if u do I will put brainliest

Answers

the first answer is 6.1 ounce less

the 2nd answer is $3.6 more

The height of the tunnel at the center is 35ft, and the vertical clearance must be 21 ft at a point of 8ft from the center. Find an equation for the parabola.


INCLUDE WORK.

Answers

Answer:

y=-0.215x^2+35

Step by Step:

Let, [tex]h=0[/tex],  [tex]k=35[/tex], [tex]x=8[/tex], [tex]y=21[/tex]

We know that, the general equation of the parabola.

   [tex]y-k = a(x-h)^2[/tex]

[tex]\Rightarrow y=a(x-h)^2+k .........(i)[/tex]

Substitute the  value of [tex]h, k, x, y[/tex] in equation [tex](i)[/tex] and find the value of [tex]a.[/tex]

  [tex]21=a(8-0)^2+35[/tex]

[tex]\Rightarrow 21=a\times 8^2+35[/tex]

[tex]\Rightarrow 21=64a+35[/tex]

[tex]\Rightarrow 64a=21-35[/tex]

[tex]\Rightarrow 64a=-14[/tex]

[tex]\Rightarrow a=\frac{-14}{65}[/tex]

[tex]\Rightarrow a=-0.215[/tex]

Hence, the equation of the parabola is:

[tex]y=-0.215x^2+35[/tex]

W + 7 < 4 you don’t have to show work

Answers

W < -3
Subtract 7 from both sides

-3a + 4 = -14
What the answer to this

Answers

Answer:

-6

Step-by-step explanation:

-3a + 4 = -14

-3a = -14 - 4

-3a = -18

a = -18 / 3

a = -6

Answer:

a = 6

Step-by-step explanation:

Step 1: Subtract 4 from both sides.

-3a + 4 - 4 = -14 - 4

+4 and -4 cancel out.

Step 2: Subtract 4 from -14 to get -18.

-3a = -18

Step 3: Divide both sides by -3.

a = -18/-3

Step 4: Divide -18 by -3 to get 6.

a = 6

Let's check our work by substituting a for 6.

-3(6) + 4 = -14

Multiply -3 by 6 to get -18.

-18 + 4 = -14

Add -18 and 4 to get -14.

-14 = -14

This is true, so a = 6.

I need help...



Please help to find ...​

Answers

Answer:

NEED TO FIND WHAT

Step-by-step explanation:

find the slope thanks ​

Answers

Answer:

Hello! Just here so the other person can get brainliest. I will do the same for the other questions.

Step-by-step explanation:

Triangle IHJ is similar to triangle RST.
What is the length of side _
RT

Answers

6 mm

Set up a proportion of 12/9=8/x. Cross multiply and this gives us 12x=72. Now divide both sides by 12 and you get 6.

Which set of side lengths form a right triangle?
2 inches, 3 inches, 4 inches
6 inches, 8 inches, 10 inches
8 inches, 9 inches, 11 inches
10 inches, 12 inches, 13 inches

Answers

Answer:

It’s 10 inches, 12 inches, 13 inches

Step-by-step explanation:

-4x + 12 = -6x
Step 1: Add 4x to both sides:
12 = -6x + 4x
Step 2: Combine like terms:
12 = -2x

Answers

uh- this is the correct way to answer the problem....

−4x+12=−6x

Step 1: Add 6x to both sides.

−4x+12+6x=−6x+6x

2x+12=0

Step 2: Subtract 12 from both sides.

2x+12−12=0−12

2x=−12

Step 3: Divide both sides by 2.

[tex]\frac{2x}{2}[/tex] = [tex]\frac{-12}{2}[/tex]

x=−6

What is the equation in point−slope form of the line passing through (−3, −4) and (0, 2)?
Use the table below to answer this question:

x y
0
2
1
−1
2
−6
Find the average rate of change for the given function from x = 0 to x = 2.

Answers

Answer:

The answer is A

Which number(s) below belong to the solution set of the equation? Check all that apply.

x + 10 = 40


A. 40

B. 80

C. 400

D. 4

E. 30

F. 50

Answers

Answer:

E only

Step-by-step explanation:

I would believe that it is only E 30

is the product of 18 negative numbers and 20 positive numbers a positive number or negative

Answers

Answer:

positive

Step-by-step explanation:

even negatives = positive

whatever positives = positive

positive*positive = positive

WILL GIVE BRAINLIEST

Find the equation of the line

perpendicular to y=-2x + 1 that

also intersects the point (8, 2).

y- Hx+ 1

Enter

Answers

Answer:

y=1/2x-2

Step-by-step explanation:

perpendicular lines have a neg. reciprocal for the slope.

for example:

in this equation y=-2x+1

-2 is the slope and the negative reciprocal would be 1/2

hence, the slop of our new line is 1/2

y=1/2x+b

we can substitute the coordinates given for x and y:

2=1/2(8)+b

2=4+b

-2=b

hence the new equation is y=1/2x-2

A $96.00 item is marked down by 25%
what is the new cost of the item?
round if needed

Answers

Answer:

$72.00

Step-by-step explanation:

Answer:

$72

Step-by-step explanation:

25% of $96 = [tex]\frac{25}{100}[/tex] × [tex]\frac{96}{1}[/tex]  [tex]\frac{25}{100}[/tex] × [tex]\frac{96}{1}[/tex] = [tex]\frac{2400}{100}[/tex]  [tex]\frac{2400}{100} = 24[/tex]  $96 - $24 = $72

I hope this helps!

A closed box has a square base with side length l feet and height h feet. Given that the volume of the box is 29 cubic feet, express the surface area of the box in terms of l only.

Answers

Answer:

The surface area of the box in terms of l is [tex]2l^2 +116/l[/tex]

Step-by-step explanation:

The length of the box = [tex]l[/tex]

The height of the box = [tex]h[/tex]

The volume of the box can be obtained by multiplying the surface area of the base by the height of the box.

The surface area of the base of the box is a square, so it will be obtained by multiplying [tex]l \times l = l^2[/tex]

hence volume = [tex]l^2 \times h =29[/tex]

Notice that we are told to give our answer in terms of l, so we will make h the Subject of the formula in the above equation.

[tex]h =29/l^2[/tex]

In the next phase, we are to find the surface area of the box.

The box has a square base, hence it will be made up of

2 squares with 4 rectangles. This is assuming the top is closed.

This means the surface area will be

[tex]2(l^2) +4 (l\times h)[/tex]

recall [tex]h = 29/l^2[/tex]

Hence, surface area =

[tex]2(l^2) +4(l \times 29/l^2)\\2l^2 +116/l[/tex]

The surface area of the box in terms of l is [tex]2l^2 +116/l[/tex]

The surface area of the closed box in terms of l only, which has the square base is,

[tex]2l^2+\dfrac{116}{l}\;\rm ft^2\\[/tex]

What is of volume of cuboid?

Volume of cuboid or box is the amount of quantity, which is obtained by it in the 3 dimensional space.

The volume of cuboid or box can be given as,

[tex]V=l\times b\times h[/tex]

Here, (l) is the length, (b) is the width of the box and (h) is the height of the box.

A closed box has a square base with side length l feet and height h feet.  Therefore, the length and width will be the same.

The volume of the box is 29 cubic feet. Thus,

[tex]29=l\times (l)\times h\\h=\dfrac{29}{l^2}[/tex]

The surface area of the square base box is,

[tex]A=2l^2+4lh[/tex]

Put the value of height,

[tex]A=2l^2+4l\dfrac{29}{l^2}\\A=2l^2+\dfrac{116}{l}\\[/tex]

Hence, the surface area of the closed box in terms of l only, which has the square base is,

[tex]2l^2+\dfrac{116}{l}\;\rm ft^2\\[/tex]

Learn more about the volume of cylinder here;

https://brainly.com/question/12748872

Evaluate functions from their graph f(-5)=

Answers

Answer:

7

Step-by-step explanation:

(-5,7) lies in the graph!

Twins Isaac and Isaiah were just born. Isaac weighs 6666 pounds 2222 ounces and Isaiah weighs 5555 pounds 4444 ounces.

Answers

Step-by-step explanation:

Kindly make the question clearer for assistance

make the question more clear pls


does anyone know this please help

Answers

Answer:

It is the 3rd graph

Step-by-step explanation:

It is the only one that shows a porpotional relationship.

Answer:

sry mate.....

............

if 50% is 10 what is 75%​

Answers

THE ANSWER IS 15 BECAUSE I DID THE MATHnehe it wotn send omg

Answer:

15

Step-by-step explanation:

hhwkdveiwvsjzvejdif

2 ( x + 1 )

it's just a simple warm up question, please hurryyy.

Answers

Answer:

2x+2

Step-by-step explanation:

It's multiplicative distribution - when you multiply something in parenthesis by another expression, you distributively multiply the expression to the expression in the parenthesis.

2x+2 (since you do not know the value of the variable you cannot go any further)

If 2 quarts of paint are needed for 75 ft of fence, how many quarts are needed for 900 ft of fence

Answers

Answer:

24 quarts

Step-by-step explanation:

1 qrt = 75/2 = 37.5

900 / 37.5 = 24

Please help with this

Answers

Answer: pretty sure its 85

Step-by-step explanation:

Answer:

85°

Step-by-step explanation:

Line segment AB || line m

Therefore, BC is transversal.

[tex] \therefore m\angle ABC + (m\angle ACB +m\angle A D) = 180\degree[/tex]

[tex] \therefore m\angle ABC + (55\degree + 40\degree) = 180\degree[/tex]

[tex] \therefore m\angle ABC + 95\degree = 180\degree[/tex]

[tex] \therefore m\angle ABC = 180\degree -95\degree [/tex]

[tex] \therefore m\angle ABC = 85\degree [/tex]

Use the rules of significant figures to answer the following question:

54.313 × 12.09

A. 657

B. 660

C. 656.64

D. 656.6​

Answers

the answer is C. 656.64

Find the unit tangent vector at the given value of t for the following parameterized curves.

r(t)= ⟨7–√e^t,3e^t,3e^t⟩

, for 0≤t≤1
; t=ln 2

Answers

Answer:

[tex]T(ln2)[/tex][tex]= <\sqrt{145} , \frac{6\sqrt{2} }{\sqrt{145} } , \frac{6\sqrt{2} }{\sqrt{145} } >[/tex]

Step-by-step explanation:

Given : [tex]r(t)=<7-\sqrt{e^t}, 3e^t,3e^t > .........(i)[/tex]

We first have to differentiate of equation [tex](i)[/tex]

[tex]r'(t) = < \frac{\sqrt{e^t} }{2} , 3e^t,3e^t> ..........(ii)[/tex]

Now to get a unit tangent vector at the given value of [tex]t[/tex], we put [tex]t = ln2[/tex] in equation [tex](ii)[/tex]

[tex]r'(ln2) = < \frac{\sqrt{e^{ln2}} }{2} , 3e^{ln2},3e^{ln2}>[/tex]

            [tex]= <\frac{1}{\sqrt{2} } ,6,6>[/tex]        [∵[tex]e^{lna}=a[/tex]]

Now to get a unit tangent vector , we will divide our vector [tex]r'(ln2)[/tex] by its magnitude. So let's first find the magnitude.

[tex]|r'(ln2)|=\sqrt{(\frac{1}{\sqrt{2} } )^2 +6^2+6^2}[/tex]

             [tex]= \sqrt{\frac{1}{2}+36+36 }[/tex]

             [tex]= \sqrt{\frac{145}{2} }[/tex]

Now we can find the our unit tangents vector.

      [tex]T(ln2)=\frac{r'(ln2)}{|r'(ln2)|}[/tex]

                  [tex]= \frac{<\frac{1}{\sqrt{2}} ,6,6> }{\sqrt{\frac{145}{2}} }[/tex]

                  [tex]= <\frac{\frac{1}{\sqrt{2} } }{\sqrt{\frac{145}{2}} } ,\frac{6}{{\sqrt{\frac{145}{2}} }}, \frac{6}{{\sqrt{\frac{145}{2}} }} >[/tex]

                   [tex]= <\sqrt{145} , \frac{6\sqrt{2} }{\sqrt{145} } , \frac{6\sqrt{2} }{\sqrt{145} } >[/tex]

Hence, [tex]T(ln2)[/tex] [tex]= <\sqrt{145} , \frac{6\sqrt{2} }{\sqrt{145} } , \frac{6\sqrt{2} }{\sqrt{145} } >[/tex]

In Mr. Romano‘s class, 40% of the students like baseball. If 14 of his students
like baseball, how many students are in Mr.Romano’s Class?

Answers

Answer:

35

Step-by-step explanation:

The number of students in Mr.Romano’s class is 35.

Given that, in Mr. Romano‘s class, 40% of the students like baseball.

What is an equation?

In mathematics, an equation is a formula that expresses the equality of two expressions, by connecting them with the equals sign =.

Let the number of students in Mr.Romano’s class be x.

Here, 40% of x = 14

⇒ 40/100 × x = 14

⇒ 0.4x = 14

⇒ x = 14/0.4

⇒ x = 35

Therefore, the number of students in Mr.Romano’s class is 35.

To learn more about an equation visit:

https://brainly.com/question/14686792.

#SPJ2

i need help pls help me

Answers

Answer:

yes

Step-by-step explanation:

Answer:

18

Step-by-step explanation:

you have to multiply 2/3 by 27 km

Hello :)
Please help me solve this

Explain answer

Answers

Answer:

[tex]Scale\ Factor = \frac{1}{2}[/tex]

ABC dilated

Step-by-step explanation:

Given

Triangles ABC and DEF

Required

Determine the scale of dilation

First, we pick a side on ABC

[tex]AB = 6[/tex]

Pick a corresponding side on DEF

[tex]DE = 3[/tex]

The scale factor is then calculated as:

[tex]Scale\ Factor = \frac{DE}{AB}[/tex]

[tex]Scale\ Factor = \frac{1}{2}[/tex]

i.e. ABC was dilated by 1/2

Eugene sold half of his comic books and then bought eight more. He now has 32. With how many did he begin?

Answers

Answer:

48 books

Step-by-step explanation:

32-8 = 24

24= 1/2 of total

24x2=48

Answer=48 books

Check:

48/2=24

24+8=32

YAY!!

Answer:

48 comic books

Step-by-step explanation:

Let's use x as the amount that he originally had.

If he sold half of them, that would be:

(1/2)x

Then he bought 8 more, so you would add 8 to that total.

(1/2)x + 8

If he now has 32 then we need to set that equation to equal 32.

(1/2)x + 8 = 32

Subtract 8 from each side.

(1/2)x = 24

Then you will divide 24 by 1/2. That is the same thing as multiplying by 2.

So,

x = 48

Check work

(1/2)x + 8 = 32

(1/2)(48) + 8 = 32

Half of 48 is 24.

24 + 8 = 32.

32 = 32.

m over 8 minus 5 equal 12​

Answers

Answer:

m = 136

Step-by-step explanation:

m/8 - 5 = 12

1. Add 5 on both sides

m/8 - 5 + 5 = 12 + 5

m/8 = 17

Multiply 8 on both sides since u are trying to isolate the variable

m/8 * 8 = 17*8

m = 136

Check

136/8 - 5 = 12

17 - 5 = 12

12 = 12

Hope it helped!

Step-by-step explanation:

[tex]\frac{m}{8}[/tex] - 5 = 12 : Original Problem

[tex]\frac{m}{8}[/tex] -5 +5 = 12 + 5 : Bringing the constants to one side

[tex]\frac{m}{8}[/tex] = 17 : Simplification

[tex]\frac{m}{8}[/tex]×8 = 17×8: Isolating the variable

m = 136 : The answer!!!

Checking the answer

[tex]\frac{136}{8}[/tex] -5 = 12 : Substitution

[tex]\frac{136}{8}[/tex] = 17 : Bringing constants to one side and simplification

136 = 17 × 8 : Isolating the answer

136 = 136 : Success!!!

I hope this is what you wanted and I hope this helps!!!

what is 4 1/2-3 5/6 from page 393 GO Math book

Answers

Answer:

The answer is 1/6

Step-by-step explanation:

This is the answer because it is.

It is 1/6
This is the answer because
Other Questions
a pulley is used to lift a 2000 N safe over frosty's head. the safe is lifted 6m in 4s by Rudolph. how much power did Rudolph use? what does hi mean in spanish -8t = 64Answer:t = ?Answer the ? Mark pls How did technology contribute to the expansion of European power through imperialism? Hey guys can one of you help me pls its only one small question The plugin that changes Jenkins to use green balls instead of blue for successful builds is ________. Decide whether the pronunciation is correct or incorrect. Drag and drop the word into the correct column.encourage en-KUR-Correct PronunciationIncorrect Pronunciationexplain ik-SPLAYNjustity JUHS-tun-tahyplayful PRET-tuhmspecial SLISP-uhtheroic hi-ray-IT An architect draws a plan for a wheelchair ramp on the plan, the ramp is 2cm high and 24cm long what might the dimensions of the actual ramp be (use equivalent ratios) slope of 2,11 and 5,2 Hey guys please help!! What is the definition of fourteen points? breakout edu keyla winter wonderland questioni CAN'T DO THIS I've tried so many times how do you do it What became of most of the Central powers colonies after World War I? They became independent nations. They remained colonies of Central Powers nations. They became League of Nations mandates. They were run by the League of Nations. TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA The slope of the line below is -1/7. Write a point-slope equation of the lineusing the coordinates of the labeled point. What might be the consequences of your choice? Political: Economic: Social: What are the two ways a subduction zone can be generated? The local lighting company found that 2 out of every 10 lightbulbs was defective. Ifthere are a total of 120 bulbs in a box, how many can they predict will be defective? Quienes intervienen en este caso de violencia? En la fragmento de la novela corazn a shop is having a sale all items are reduced by 30% work out the sale price of an item normally priced at 110