Asexual reproduction can be advantageous for species that colonize new areas.

A. True

B. False

Answers

Answer 1

Answer:

True

Explanation:

It can rapidly increase if the environment is good for them


Related Questions

3.4.3 Lab: Why are cells so small?

Answers

Answer: The important point is that the surface area to the volume ratio gets smaller as the cell gets larger. Thus, if the cell grows beyond a certain limit, not enough material will be able to cross the membrane fast enough to accommodate the increased cellular volume. ... That is why cells are so small.

Explanation: because they can absorb nutrients much more efficiently. Because they are smaller they can efficiently absorb enough food. ... When a cell doubles in size the volume increases much more then the surface area, which is why large cells cannot receive enough food efficiently for their volume. Cells are small because they are more efficient as smaller entities. Information within small cells is transmitted more quickly and efficiently than within larger cells. ... Thus a higher cell surface area-to-volume ratio, i.e., smaller cell size, is desired for most efficient cellular activity.

The cells are so small because their small size allows them to take in food and get rid of the waste.

The cells are the basic structural and functional unit of all organisms on earth except the Viruses. The size of the cell is so little it allows the organism to maximize the ration of surface area to volume. Smaller cells are expected to have greater ratio which promotes more molecules as well as ions to move across the plasma membrane.The small size of the cell facilitate to get the nutrients inside the cell and waste outside the cell quickly. Hence, small size of cell facilitates to get food inside and get rid of waste.

Learn more about cell:

https://brainly.com/question/3142913

MARKING PEOPLE AS BRAINLIDT IF CORRCET

True or False: Bone cells contain different DNA than blood cells.

Answers

Answer:

True the bone cells do have different DNA than blood

Explanation:

True.
bone cells and blood cells do different things, hence the different DNA

A botanist finds that when compared to pink flowers, the population of purple flowers is very high. Ten years later, the population of purple flowers is nearly gone, and the number of pink flowers has tripled. Why would this be?

Answers

Answer:

Because of the reduction or near extinction of the purple flowers noticed by the botanist Ten years after it was in abundance, this fall in the population could be caused by the unfavorable change in the plant's environment. While the pink flowers tripled because some factors in the environment were favorable for its growth.

Explanation:

From the question, it was mention that the botanist noticed at first purple flowers had more population than the pink flowers and that changed after 10 years when the population of the pink flowers tripled and purple flowers were nearly gone. Some of the causes that could be responsible are:

1. Disease and pest attack on the purple flowers.

2. The pink flowers developed a good survival mechanism even in adverse conditions.

3. Environmental stress could also come into play on the purple flowers.

4. Climate which initially supported the growth of the purple flowers had changed. Because variations exist in plants and the ideal conditions necessary for plant growths and proliferation varies among plants.

.

explain how water properties help get water from the roots of plants to leaves

Answers

Answer:

In order for water to move through the plant from the soil to the air (a process called transpiration), soil must be > root > stem > leaf > atmosphere. ... Because of this difference in water potential, water will move from the soil into a plant's root cells via the process of osmosis.

Explanation:

Pls help :)) worth 10 points (:

Answers

Answer:

A

Explanation:

just go for A

which statement describes what happens to rocky shorelines that absorb energy from ocean waves?

Answers

Answer:

Solid rock break apart

Explanation:

Desert plants and animals are adapted to the lack of what and high

Answers

The two main adaptations that desert animals must make are how to deal with lack of water and how to deal with extremes in temperature. Many desert animals avoid the heat of the desert by simply staying out of it as much as possible

Answer:

lack of water and high concentration of heat and dryness

Explanation:

Deserts don't get that much rainfall, so desert wildlife are adapted to survive in such a dry climate. Take the camel, for instance, it can store three bathtubs of water in it's hump, so it can go a very long time without water. And without that rainfall, the desert is dry and, usually, very hot. Animals have adapted to this by only coming out in the nighttime when it's cooler.

hope this helped:)

PLEASE HELP I WILL MARK BRAINLIEST. Listed in the Item bank are key terms and expressions, each of which is associated with one of the columns. Some terms may display additional information when you click on them. Drag and drop each item into correct column. Order does not matter. PLEASE HELP

Answers

Producer: Grass, trees, algae

Consumer: Birds, cows, humans

Decomposer: Earthworms, fungi, mushrooms

Answer:

Producer: Grass, trees, algae

Consumer: Birds, cows, humans

Decomposer: Earthworms, fungi, mushrooms

Explanation:

Hope This Helps!

Please Mark Me Brainly!

What might be the consequences of your choice?
• Political:
• Economic:
• Social:

Answers

Answer:

Political: Lobbyists.

Economic:Farmers and industrial companies will significantly reduce their output and reduce local jobs. The companies that sell pesticides and fertilizers to local companies will also suffer losses. Farmers will suffer the most if they are unable to find safer fertilizers and pesticides to use.

Social:After a period of time, water pollutants will reduce to safe levels. This could be a long wait. Poverty may increase in the region due to lost jobs and income.

Explanation:

Please I need Help!!
● Prophase I
● Metaphase I
● Anaphase I
● Telophase I
● Prophase II
● Metaphase II
● Anaphase II
● Telophase II

Answers

Answer:

Its in this order: 3 - 4 - 1 - 6 - 5 - 7 - 2 - 8

Explanation:

I learned this a while ago so I would know

Help I need helpppppppoo

Answers

meters per second. distance is meters and time is seconds
meters per second I’m right

plz help me i beg of you!???

Answers

Answer:

Pretty sure it's D, because the birds beak evolves to crush those grains as a result of certain food available in their habitat, although it does not say "diet" as an option so D is your best guess.

Explanation:

Please help I will give a brainliest

Answers

Answer:

answer

Explanation:

im not that good w these sorry

Whats the answer giving brainliest HELP!!!!!

Answers

Answer:

I feel like the first one is the best

Explanation:

widening the roads will just cause more cars.

raising the price is most likely not gonna help but its an option.

expanding just means more cars

In organisms other than plants, when and where is the most ATP produced?
in cytoplasm, during photosynthesis
in nuclei, during cellular respiration
in chloroplasts, during photosynthesis
in mitochondria, during cellular respiration

Answers

Answer:

D. In mitochondria, during cellular respiration.

Explanation:

A cell can be defined as the fundamental or basic functional, structural and smallest unit of life for all living organisms. Some living organisms are unicellular while others are multicellular in nature. A unicellular organism refers to a living organism that possess a single-cell while a multicellular organism has many (multiple) cells.

All living organisms such as plants and animals require energy to function properly (life activities). Thus, the organelle where energy from nutrients is released is generally referred to as mitochondria. Animals retrieve energy using mitochondria to do cellular respiration because they typically act like a digestive system by taking in nutrients, breaking them down and obtaining energy rich molecules for cell-life activities.

Cellular respiration can be defined as a series of metabolic reactions that typically occur in cells so as to produce energy in the form of adenosine triphosphate (ATP). During cellular respiration, high energy intermediates are created that can then be oxidized to make adenosine triphosphate (ATP). Therefore, the intermediary products are produced at the glycolysis and citric acid cycle stage.

Basically, mitochondria is one of the cell organelles found in all living organisms and it is known as the powerhouse. Therefore, mitochondria provides all the energy required in the cell by transforming energy forms through series of chemical reactions; breaking down of glucose into Adenosine Triphosphate (ATP) used for providing energy for cellular activities in the body of living organisms.

In organisms other than plants, the most ATP is produced in mitochondria, during cellular respiration.

Answer:

D

Explanation:

got it right on edge

The pigment plants have that they use for photosynthesis is called ————

I don’t want a explanation I just want the answer


Answers

Answer:

chlorophyll is the answer

18. How has the use of herbicides affected agricultural productivity?
O A. Fewer crops are organic because of the use of Bt toxin.
B. Fewer pesticides are needed because of parasitoids.
O C. Fewer people are needed to weed because of herbicides.
D. Fewer crops are produced because of herbicides.

Answers

Answer:

B. Fewer pesticides are needed because of parasitoids.

Explanation:

Herbicides are chemicals utilized to manage or command unwanted vegetation. Herbicide employment happens most commonly in row-crop cultivation, where they are employed before or throughout seeding to maximize yield productivity by decreasing other vegetation.  Yields have improved considerably, and, in association with tillage, herbicide use decreases erosion, fuel usage, greenhouse gas discharges, and nutrient run-off, and preserves water.

What boundary is present at the Philippine plate and the Eurasian plate?
A convergent boundary resulting in earthquakes and volcanic activity
B transform boundary resulting in fault lines and shallow earthquakes
C divergent boundary resulting in mid-ocean ridge and creation of new sea floor
D convergent boundary resulting in mid-ocean ridge and widening of ocean basic

Answers

Answer:

D

Explanation:

When is carbon dioxide used during photosynthesis?
A. Light- independent reaction
B. Light-dependent reaction
C. Carbon dioxide is made, not used

Answers

Answer:

Pretty sure its b.

Explanation:

How does the double helix structure of DNA support its role in encoding the genome?
1)The sugar-phosphate backbone provides a template for DNA replication
2)tRNA pairing with the template strand creates proteins encoded by the genome
3)Complementary base-pairing creates a very stable structure
4)Complimentary base pairing allows for easy editing of both strands of DNA

Answers

Answer: Complementary base- pairing creates a very stable structure

Explanation:

The double helix structure of deoxyribonucleic acid (DNA) support its role in encoding a genome because the: 3. Complementary base-pairing creates a very stable structure.

A double helix can be defined as the spiral configuration of the deoxyribonucleic acid (DNA) molecule.

In Biology, a double helix is typically used to describe the molecular structure of a double-stranded deoxyribonucleic acid (DNA) molecule, which comprises two (2) linear strands that are complimentary and run opposite to each other and twist together (anti-parallel).

Hence, the complementary base-pairing in a double-stranded deoxyribonucleic acid (DNA) or double helix structure of deoxyribonucleic acid (DNA) helps to create a very stable structure, which in turn makes it possible to encode a genome.

Read more: https://brainly.com/question/19755749

Clever ones this is one for you

If you throw a pebble into a pond, ripples spread out from where it went in. These ripples are waves travelling through the water. The waves move with a transverse motion. The undulations (up and down movement) are at 90° to the direction of travel.​

Answers

Answer:

so please Indicate your question

During a period of drought, members of a community may volunteer to water their lawns every other day, rather than daily. The most important benefit of this action is - It adds nitrogen to the soil It fertilizes the soil It reduces air pollution It conserves the groundwater supply​

Answers

Answer:

hi love you have a nice day      

Explanation:

I Will Give BRIANIEST
A scientist tests the water in a local pond and finds that it has a pH of 7.9.

What is true about the water sample?

Choose 1 answer:


(Choice A)
A
It is basic.


(Choice B)
B
It is acidic.


(Choice C)
C
It is neutral.


(Choice D)
D
It is both basic and acidic.

Answers

Answer:

it is Basic brooooooo. No B NOT C AND NOT D. oNly A

The answer is A. The ph of regular water is about 7.0 or so. so since it's 7.9 it means it's basic. You're welcome :)

Lister cultured the bacteria responsible for milk spoilage.
True
False

Answers

Answer:

True

Explanation:

a sedimentary rock formed from clay deposits

Answers

Answer:

is it shale

sorry if that's not right it's kinda confusing how you put the question

Explanation:

An organism is currently using light energy to make food. Based on what you have learned, this organism will be best classified as

Answers

Answer:

This organism is best classified as an autotroph.

Explanation:

Autotrophs can make their own food.

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Answers

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

What is the independent variable?

What is the dependent variable?

Answers

Answer:

the independent is the age of the tree and the dependent is the diameter

Explanation:

the diamter of the tree is based off of the age as we can see that it gets bigger the older the tree is

Answer: Independent variable: age of the tree (years), Dependent variable: tree diameter (mm)

The diameter of the tree is dependent on what age the tree is. As the tree gets older, the diameter increases. The dependent variable depends/relies on the value(s) of the independent variable.

the combination of a heart arteries and veins and capillaries is____​

Answers

Answer:

A (an organ system)

Explanation:

which of the following are part of the central nervous system?​

Answers

Answer:

The central nervous system is made up of the brain and spinal cord

Explanation:

ion if that's the answer you were looking for but here go.

Other Questions
3) The center of life in Athens was...*A) The ParthenonB) The AcropolisC) The AgoraD) None of the Above can u pls help me with this question Identify the two values of x that make 10x 8 > 2(4x + 2) true. what is the value of y intercept of the graph of h(x)=32(2.9)^x help pls , thank you for all who comment ! In a right triangle the length of a hypotenuse is c and the length of one leg is a, and the length of the other leg is b, what is the value of b, if c=5, a=3 HELP i need to name this for my art class, Plz i need ideas.. Utop you answer questions 8:10. Each unit on the graph represents 0.75 miles Roundanswers to the nearest font when necessaryGROCERY STOREJIM'S HOUSE20191817101514131211109876543210BANKMALL0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 206. How many miles is Jim's house from themali?7. Is Jim's house closer to the mall or thebank? How many miles closer is it?8. Jim is at his house, and his car has 25miles until it runs out of goo Would Jim boable to make it from his house to the grocerystore and back without stopping for gos?Explain9. Jim loft his house and drove to the bankOn his way back home, Jim's wife calledwhen he was exactly half way home. Howmany miles had Jim traveled when his wifecalled?10. Jim is hoping that a park will be built within 5 miles of his house. If a park is built at thecoordinates (12, 10), does that meet Jim's criteria? Explain.Moreovering the Middle LLC, 201610PRB Solve for X6(x + 2) = 66X = Mary bought 50 apples at the apple orchard. She bought 4 times as many red apples as green apples. How many more red apples than green apples did Mary buy? Read the excerpt from Beowulf. Which of Heorot's qualities do these lines deict? Which of the following events would be part of the climax of the story? (A) Jenna was hiking with her mom in New Mexico (B) About an hour into the hike, a bad storm hits(C) They decide to go home and get out of their drenched clothes. (D) They find a rock and hide under it while the storm passes.IIf u get it right you get brainliest o(**)o When you stepon a scale, what is beingmeasured? Helppp Select the correct answer.Which of these developments took place recently with an aim to bring back the popularity of radio? .FM radios were introduced to listeners.OB.International radios were introduced to listeners..AM radios were introduced to listeners.ODSatellite radios were introduced to listeners. Hydrogen bromide is a chemical compound. Its formed from atoms of hydrogen and bromide, twoAelectrons.Belements.Cneutrons.Dnuclei. Which of the 4 regions has the most extreme weather temperature?Mountain and basin Great Plains Central Coastal plains Which phrase includes a qualifier?A. Lakes and streams in summerB. A lake in summerC. The lakes in summerD. Sometimes lakes in summer chile yall i need HALP What is 2.5 x 10^-5(the "^" means that the number after is an exponent what type of waves are used on a tv remote control?