ASAP
My topic is about spray irrigation and I want to know why do we do this with the spray irrigation

Answers

Answer 1

Answer and Explanation:

Spray irrigation is used because it allows water to reach the common soil with less impact, without stimulating soil compaction. In addition, this irrigation method promotes better water distribution, irrigation control, optimization of water volume, reduction of waste and better use of water by the plant. All of these benefits outweigh the high price of this type of irrigation and allow many people to prefer this irrigation over other less efficient methods.

Answer 2

Answer:

water is pushed from a well into an apparatus that then sprays the water across the field

Explanation:


Related Questions

If the students of Santa Fe High School still wished to pray before home football games, explain how they could accomplish this without violating the First Amendment, as stated by the Court.

Answers

Answer:

Santa Fe Independent School District v. Doe, case in which the U.S. Supreme Court on June 19, 2000, ruled (6–3) that a Texas school board policy that allowed “student-led, student-initiated prayer” before varsity high-school football games was a violation of the First Amendment’s establishment clause, which generally prohibits the government from establishing, advancing, or giving favour to any religion.

the issue that eventually reached the U.S. Supreme Court concerned a policy that called for students to vote on whether prayers would be delivered prior to football games and to select a student who would deliver them. After the students approved the inclusion of prayers at the game, a federal district court ruled that only nonsectarian and nonproselytizing prayers could be delivered. The Fifth Circuit Court of Appeals, however, ruled that any football prayer was unconstitutional, as a violation of the establishment clause.

The school board contended that control of the pregame message was left to students who also chose the speaker and the content of the message by a majority vote. Thus, according to the board, the prayer qualified as “private speech” and was protected by the First Amendment’s free speech and free exercise clauses. However, the court ruled that The court was of the opinion that the policy would only lead to student messages that were, rather than private speech, actually religious speech directly sponsored and endorsed by a governmental agency.

In 2000, the Supreme Court ruled in the case of Santa Fe Independent School District v. Doe that student-led prayer at public school events, such as football games, violates the Establishment Clause of the First Amendment.

What is First Amendment?

The United States Constitution's First Amendment is part of the Bill of Rights, which was ratified on December 15, 1791.

In the case of Santa Fe Independent School District v. Doe, the Supreme Court ruled in 2000 that student-led prayer at public school events, such as football games, violates the Establishment Clause of the First Amendment.

As a result, school officials are not permitted to organise, promote, or participate in student-led prayer at these events.

Individual students, however, are not prohibited from praying before, during, or after school events on their own or with other like-minded students.

Students are free to express religious beliefs as long as they are not school-sponsored, school officials do not endorse or promote it, and it does not interfere with the educational environment or the rights of others.

Thus, this way, they could accomplish this without violating the First Amendment, as stated by the Court.

For more details regarding First Amendment, visit:

https://brainly.com/question/1078243

#SPJ3

2) What was the impact of the new and improved caravel ship in
exploration?
A.) The new caravel was faster, but clumsier contributing to a lag in trading.
B.) The new and improved caravel made exploration and trade amongst nations more even.
C.) The new and improved caravel gave Portugahan
advantage in exploration and trading in the world.
D.) The caravel increased the time it took to trade due to the new size of the ship, thus impacting the
efficiency of trade.

Answers

Answer:

B.

Explanation:

The caravel was a ship used to explore the New World in the 15th and 16th Century, during the Age of Discovery. The Caravel was developed and modified from simple fishing ships to sailing ships by Portuguese to explore the African coast and the Atlantic Ocean.

The new and improved caravel made it possible for European to explore and colonize the New World. With the desire to expand their boundaries of politics, economy, religion, and science, they explored the New World using the Caravel.

Therefore, option B is correct.

In a class of students, the following data table summarizes how many students play an instrument or a sport. What is the probability that a student chosen randomly from the class does not play a sport?
Plays an instrument Does not play an instrument
Plays a sport 8 7
Does not play a sport 3 12

Answers

Answer:

79.31%

First we need to find the total number of students.

We do that summing all the four values in the table:

Total students = 2 + 18 + 3 + 6 = 29

Then, the students that play a sport or an instrument are all student but the ones that don't play both:

Students(sport or instrument) = 29 - 6 = 23

So the probability of a random student playing a sport or an instrument is 23/29 = 0.7931 = 79.31%

Nazi Germany practiced subjugation.
Please select the best answer from the choices provided
ОТ
OF

Answers

Answer:

T

Explanation:

egg 2021

Can someone answer my other question?. :(

Answers

Answer:

what is the question my guy

Which class is the best one to take? Also could you please explain why you chose the one that you did?
1. AP Euro
2. AP Psych
3. AP World

Answers

Answer:

AP Psych

Explanation:

In my opinion, it will take you farther in college than AP Euro or World would. You'll be suprised to find how many majors require Psychology. First, it is both a social science and biological science. If you are taking, AP bio/AP chemistry or any other science AP psych is the way to go. You go over neurotransmitters and their major functions and how relate to our behavior. I would also take this class if you have previously taken AP biology/chemistry because you will begin the class already knowing about neurotransmitters, inhibitors, and receptors. I took AP bio last year and am taking AP Psych this year and I currently have an A because I am educated on neurological functions. Even if you haven't taken bio or chemistry I would still highly suggest psychology because it prepares you for college and enhances your understanding of society and your own emotions.

Which of the following is NOT an example of a daily routine used as a teaching strategy?
a. Nap time
b. hand washing
c. Sharing toys
d. Restroom breaks

Answers

Answer:

Sharing toys

Explanation:

I'd say sharing toys sense we are going through a pandemic it's not very smart to be sharing things that other people have touched.

Aisaka here- to grant your wishes! 3 per person ^^

Answers

Thankyou magical genie that's out of the lamp !!!!!

Crude birth rate 38/1,000 individuals
Crude death rate 24/1,000 individuals
Net migration rate 2/1,000 individuals
(i) Calculate the national population growth rate for country X. Show your work.

(ii) Using the rule of 70, calculate the doubling time for this population.

Answers

Answer:

40-24 = 1616/1000 = 0.016 x 100 = 1.6% growth rate

70/1.6 = 43.75 years = doubling time.

The national population growth rate for country X is 1.6%

Crude birth rate = 38/1,000 individuals

Crude death rate = 24/1,000 individuals

Net migration rate = 2/1,000 individuals

The national population growth rate for country X will be:

= [(38 + 2) - 24] / 1000

= 16/1000

= 0.016

= 1.6% growth rate.

Using the rule of 70, the doubling time for this population will be:

= 70/1.6

= 43.75 years

Therefore, the doubling time for this population is 43.75 years.

Read related link on:

https://brainly.com/question/19522837

Ebecca reads a book at a rate of 1 page every 4 minutes. If her reading rate remains the same, which method could be used to determine the number of minutes for her to read 16 pages. Group of answer choices add 4 and 16 divide 16 by 4 multiply 4 by 16 subtract 4 from 16.

Answers

Answer:

Multiply 4 by 16

Explanation:

Given

[tex]Rate = 1\ page/4\ minutes[/tex]

Required

Select the method that maintains her rate for 16 pages

To get the method for 16 pages, we simply multiply 4 by 16. This is shown below

[tex]Rate = 1\ page/4\ minutes[/tex]

Calculate the unit rate

[tex]Rate = \frac{1}{4} page/min[/tex]

[tex]Rate = 0.25 page/min[/tex]

For 16 pages, it is:

[tex]Rate = \frac{16 page}{4 min * 4}[/tex]

[tex]Rate = \frac{16 page}{4 min * 16}[/tex] -- Here, we multiply 4 by 16

[tex]Rate = \frac{16 page}{64\ min}[/tex]

[tex]Rate = \frac{16}{64} page/min[/tex]

[tex]Rate = 0.25 page/min[/tex]

See that the unit rates remain the same.

Other options will give different rates

which of the following best describes how the author represents western American history written by Euro-Americans paragraph four sentence four
(in western American history were invite euro Americans he is popularly regarded as the conqueror of both General George crook and Lieutenant Colonel George Custer)

Answers

Answer:

Explanation:

The answer is music found or relocated in the western hemisphere; specifically, music’s of euro-American origins, especially western classical music. Created in the tradition of European "high are" music’s. Typically composed and notated. Western art in expressions of consecutive periods and or actions, counting classical, medieval.

Based on the information given, the correct option is that he acknowledges it while suggesting Lakota stories offer a different perspective.

It should be noted that the author represents western American history written by Euro-Americans in paragraph four. This was vital in portraying his own perspective.

Therefore, he acknowledges it while suggesting Lakota stories offer a different perspective.

Learn more about excerpts on:

https://brainly.com/question/1877100

A study was conducted on the effects of long-term marriage (more than 10 years).
Researchers gathered data from a random sample of 4,563 adults and measured
quite a few variables, in addition to the explanatory variable of marriage and the
response variable of longer life span. According to a newspaper article summarizing
the study, those in long-term marriages were more likely to be more physically
active, at a healthy weight, and nonsmokers. Those who were not married were
about 20% more likely to be deceased. What conclusion can we draw from this
study? Explain.
D We can infer a cause-and-effect relationship because the sample was selected
randomly.
We cannot infer a cause-and-effect relationship because treatments were not
assigned randomly.
) We cannot infer a cause-and-effect relationship because we do not have a
control group.

Answers

Answer:

E

Explanation:

Develop an argument that evaluates how the Columbian Exchange affected peoples in Afro-Eurasia in this time period.

Answers

By far the most dramatic and devastating impact of the Columbian Exchange followed the introduction of new diseases into the Americas.People who lived in Afro-Eurasia had developed some immunities to these diseases because they had long existed among most Afro-Eurasian populations.

hope this helps!

The evaluation of the effect of the Columbian Exchange on the people in A''fro-Eurasia is that there was the introduction of new diseases.

What is Social Interaction?

This refers to the mingling between people of different societies and civilizations where they meet and exchange ideas and cultures.

Hence, we can see that through the Columbian Exchange, there was a social interaction between the explorers and the peoples of A''fro-Eurasia which brought them new diseases that killed them in droves.

Read more about socialization here:

https://brainly.com/question/10455747

#SPj2

Question 3 of 10
Which of these must be true for an agricultural technique to be considered
sustainable?
A. It must meet society's needs while minimizing environmental
impact.
O B. It must protect the environment at all costs.
OC. t must serve present society at the cost of future generations.
D. It must use only traditional farming practices.

Answers

Answer:

A. It must meet society's needs while minimizing environmental

impact.

Explanation:

Given that sustainability is the practice of utilizing and maintaining natural resources without causing defects to biodiversity balance.

Hence, for an agricultural technique to be considered sustainable "It must meet society's needs while minimizing environmental impact."

This implies that there should be a balance between natural resource exploitation and ecological balance, such that humans can enjoy both the resources and nature without one affecting the other and at the same time, with no negative effect on humans.

Explain the process by which the Industrial Revolution spread to one country in Europe other than Great Britain.

Answers

Answer:

The industrial revolution spread to other countries in Europe, because British professionals were hired by other countries.

Explanation:

The industrial revolution was a technological breakthrough that started in England and became something very profitable, making other countries want it too. However, the English government, trying to thwart competition, prohibited industrial machines from being exported to other countries, however, other European countries began to make very generous job offers to English professionals who knew how these machines work and thus the revolution industrialization started to spread.

It should be noted that the Industrial Revolution did not spread to Britain because British entrepreneurs forbade the export of machinery and skilled workers.

The Industrial Revolution was simply the transition to new manufacturing processes in continental Europe and the United States.

The Industrial Revolution did not spread to Britain because British entrepreneurs forbade the export of machinery and skilled workers.

Learn more about Industrial Revolution on:

https://brainly.com/question/13323062

PLS HELP GIVE BRAINLIEST!!!! Which of the following is an important cultural landmark for the Christians?
A. Mecca and Medina
B. the Tombs of the Prophets
C. the ancient mosque of Al Aqsa
D. the Via Dolorosa

Answers

Answer:

d

Explanation:

Answer:

d

Explanation:

Other Questions
Which of the following Indian commodities was essential to European diet, and a big lure of European action in the Indian Ocean basin A - Pepper B - Salt C- Paprika D - Corn Which graph shows the system of equations{2x+3y=5 4x5y=1 Solve the equation:8n8=72Select one:n=20n=2n=8n=17 anong mga salita ang maiugnay sa salitang plano A similarity between Woodrow Wilson and Theodore Roosevelt was that bothO believed monopolies were bad for the country.O kept the United States out of foreign wars.O were candidates for two different parties.O were strong champions for the environment Select the sentence that contains a noun clause. BRAINLIST Leah spent three times the amount Damean spent on CDs. Damean spent $33.87. How much did Leah spend on CDs? 6 is 16% of what number? Choose one of the three themes (social oppression, greed, or good vs. Evil) and explain something you know about it in the real world OR explain where else you have seen the theme (a book, movie, show, etc.) Please help quick A 12,000-gallon pool is being filled at a rate of 40 gallons per minute. At this rate, how many minutes will it take to fill the pool 3/4 full? Explain the role that Benjamin Franklin played during the American Revolution.. Read this excerpt from the Supreme Court's Hazelwood v. Kuhlmeier dissenting opinion: The state educator's undeniable, and undeniably vital, mandate to [teach] moral and political values is not a general warrant to act as "thought police" stifling discussion of all but state-approved topics. . . . Official censorship of student speech on the ground that it addresses "potentially sensitive topics" is . . . impermissible.4 The reasoning in this opinion is most similar to the reasoning in which other Supreme Court ruling? A. New Jersey v. T.L.O. B. Miranda v. Arizona C. Gideon v. Wainwright D. Tinker v. Des Moines 1. Many plants can reproduce asexually. How is this an advantage for the plant? Why can it sometimes be a disadvantagefor the plant? Use details to support your answer. PLS ANSWER ASAP. ILL GIVE BRAINLIEST! Match the system for each of the following bodily organs.1.Nose a. Skeletal System2.Skull b. Circulatory System3.Kidneys c. Urinary System4.Veins d. Respiratory System Fill in the blank with the appropriate preposition.Paris est _____________ New York.a.) prs deb.) loin dec.) surd.) dans plz help timed MATHHHH 12 pointes Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) Select one of the readings in this unit, EXCEPT the Gettysburg Address, and in at least 150 words, discuss the historical context or cultural context the author demonstrates. How did Tisquantum help the Pilgrims????i will give brainliest and extra points Find the value of x in the image