Answer:
Traits.
Explanation:
Traits in an organism are controlled by the genes. These genes are made up of DNA that is responsible for the unique appearance of the organisms. Some organisms are different from one another because of the DNA that helps the to perform different functions. In the DNA, all information is present about form and structure of the organisms so that's why we can say that traits or characteristics are controlled by genes.
PLEASE HELP! 20 POINTS!! Explain how genes relate to the presence of dominant and recessive traits
Answer:
Fires often remove alien plants that compete with native species for nutrients and space, and remove undergrowth, which allows sunlight to reach the forest floor, thereby supporting the growth of native species. ... Overall, fire is a catalyst for promoting biological diversity and healthy ecosystems.
Explanation:
What environmental factor in the soil affects the coloration of a hydrangea plant?
Which of the following describes positive feedback?
Select one:
A. A loss of output from the body’s receptors.
B. The response of the body to increased temperatures.
C. An event that reduces the effects of a stimulus.
D. An event that enhances the original stimulus.
Select the true statements about mitosis and meiosis
Mitosis creates haploid cells
Mitosis creates cells with a complete set of genetic instructions
Meiosis create diploid cels
Meiosis creates cells with a complete set of genetic instructions
o Meiosis creates haploid cells
Mitosis creates diploid cells
Answer:
Mitosis creates cells with a complete set of genetic instructions, Meiosis creates haploid cells , Mitosis creates diploid cells
Explanation:
Someone please help meee ;-;
Review
Bookmark
DNA Unit Test (Spring 2021) / 19 of 29
What is most likely to result when a mutation affects a DNA sequence?
A. The codons will be unable to create bonds with the enzymes.
B. The nucleic acids will be unable to create bonds with the ribosomes.
C. The amino acid sequence will be changed and a different protein will be formed.
D. The protein sequence will be changed and a different set of nucleic acids will be formed.
Answer:it’s A
Explanation:
Which of the following describes positive feedback?
Select one:
A. A loss of output from the body’s receptors.
B. The response of the body to increased temperatures.
C. An event that reduces the effects of a stimulus.
D. An event that enhances the original stimulus.
How would I describe the movement of molecules, if I drop food coloring into a glass of water?
Please complete the following DNA strands
1. AGGTCCAAGCTCAAATTTCCCC
2. GAAACCCCTTAAACCTTAATTCC
3. GCGCGCGCAAATTTTTCCCATCT
Please complete the following strands using RNA:
1. AGGTCCCAAAGGCCCTTTCC
2. UAAAGGGCCCAGCCCACC
3. CUAAAAGGGGGUUUUAACC
Which statement accurately describes calories and Calories? A kilocalorie is equal to 1000 Calories. A kilocalorie is equal to 1000 Calories. A Calorie is equal to 100 calories. A Calorie is equal to 100 calories. A calorie is equal to 1000 Calories. A calorie is equal to 1000 Calories. A Calorie is equal to a kilocalorie. A Calorie is equal to a kilocalories.
Answer:
A kilocalorie is equal to 1000 Calories.
Explanation:
This is because 1000 calories make kilocalorie and it is the unit of energy in nutrition. It is the energy needed to raise temperature of 1 litre water to one centrigade or Celsius at sea level or is the amount of energy needed to cause increase of one degree Celsius of water.
In 1980, the __________ was passed to identify hazardous wastes and their life cycles.
A)
National Environmental Policy Act (NEPA)
B)
Resource Conservation and Recovery Act (RCRA)
C)
Integrated Waste Management ACT (IWMA)
D)
Americal Recovery and Reinvestment Act (ARRA)
E)
Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA)
Answer:
E
Explanation:
Right on Edg
Answer:
e.) CERCLA
Explanation:
CERCLA was passed in 1980 as a way to begin developing practices to handle and clean up hazardous wastes.
Which invertebrate from the picture did you choose from Figure 1? HINT: There is only 1 on there to choose.
Explain how body plan and anatomy enables your chosen invertebrate to perform the essential functions it needs to survive.
Answer:
Octopus (Behind the octopus's head, directly opposite the arms, is its mantle. The mantle is a highly muscled structure that houses all of the animal's organs. Its gills, hearts, digestive system and reproductive glands are all crammed into this one space)
Explanation:
I'll give brainliest
Has anyone done the 4.06 Enzymes Lab?
I don't need help on the lab part just the hypothesis.
I'm terrible at writing a hypothesis.
ACCESS 2021
The starfish's water-vascular system is used for locomotion and capturing food. True/False
Answer:
true
Explanation:
What do the following membranes surround?
Answer:
the cell wall surroundnd the membrane
This Is for today help!!
How is carbon moving between the air and found it decreasing
Answer:
Animals and plants need to get rid of carbon dioxide gas through a process called respiration. Carbon moves from fossil fuels to the atmosphere when fuels are burned.
The oceans, and other bodies of water, absorb some carbon from the atmosphere. The carbon is dissolved into the water.
Explain how a concentration gradient, a membrane protein, and hydrogen ions work together to provide a mithochondrion with energy.
Answer:
Mitochondria within the electronic transport chain, are responsible for producing the energy that the cell needs, adjusting its operation to meet the metabolic needs of the body.The mitochondrion is the place where oxygen is consumed from aerobic organisms through various electron carriers and proton translocators (H +).
Explanation:
The lipid matrix of the membrane provides an impermeable barrier to ion translocation, as well as a topological organization to the catalysts in the membrane matrix that allows them to transport both e- and ions within and across the membrane in vector form. The transformation of oxidative energy into other forms of energy is carried out, initially, by generating a transmembrane electrochemical potential difference of H + ions (protomotive force). This force is the product of the asymmetric distribution of H + on both sides of the membrane, as those are translocated through it by the enzymatic complexes of the respiratory chain.The protomotive force is made up of two closely related components: one, function of the difference in chemical concentration of hydrogens across the membrane (a pH gradient) and another, dependent on the difference in electrical charge of H + ions on both sides of it (an electrical potential gradient). Gradients of electrical charge and chemical potential produce a field in which a force is exerted that tends to attract previously expelled protons into the mitochondria. It is the enzymatic complex of ATPase, the means by which the thermodynamically reversible translocation of H + ions is catalyzed. At the same time, the chemical activity of the H + on both sides of the membrane causes a change in the equilibrium constant of the enzyme, inducing it to catalyze the synthesis of ATP.
What is the major cause of changes in gene expression?
What might happen to a desert biome if the area received more rain than it normally receives over an extended period of time? Describe some of the changes that you might expect to see
Answer:
Desert biome will change.
Explanation:
Desert biome will change if the area received more rain than normal it receives over an long period of time because the vegetation on that area appears. The change in rainfall pattern in the desert area changes the animals present in this region because the temperature of the desert is no longer suitable for the desert animals so they migrated and other organisms come to this place.
1. If the DNA sequence of a gene
was TACTTACCGAGCTAGACT
then what is the sequence of the
messenger RNA?
-|
Answer:
ATGAATGGCTCGATCTGA or AUGAAUGGCUCGAUCUGA
Explanation:
A-T or U
G-C
C-G
T-A
The transcript of the gene that creates the protein is known as messenger RNA (mRNA). The transcription of the DNA sequence results in the production of mRNA.
What is the funda of the DNA sequence and the mRNA sequence ?The DNA sequence and the mRNA sequence are complementary, which means that the mRNA sequence is the DNA sequence's reverse complement. The nucleotides are organised in the 5'-3' orientation in the provided DNA sequence. The nucleotides must be read in the 3'–5' orientation in order to get the mRNA sequence.
As a result, the mRNA sequence is AGACTGCCATGAAGTT. Because the mRNA sequence is composed of the DNA sequence's complementary nucleotides, it is the reverse complement of the DNA sequence.
For instance, the DNA sequence's first nucleotide, T, and its complementary nucleotide, A, which is the This is the mRNA sequence's first nucleotide. The second nucleotide of the DNA sequence is A, while the second nucleotide of the mRNA sequence is U, which is complementary to A. The sequence is consistent with this pattern.
Learn more about mRNA at :
https://brainly.com/question/29314591
#SPJ2
Crossing-over and nondisjunction take place during the process of
1.mitosis
2.meiosis
3.internal fertilization
4.binary fission
Someone help please and thank you
Answer:
2.meiosis............
Which of the following are sites where waste products are released from the body but not where they are produced
O skin and anus
O large intestine and small intestine
O liver and kidney
O tubules and ureters
Answer:
Its A skin and anus
(just did test)
Explanation:
The skin and the Anus are sites where waste products are released from the body but not where they are produced.
Which process of the human body eliminates the waste products?Excretion is the biological process through which any unwanted or waste products are eliminated from the body.
Large and small intestines produce waste products that are not completely digested by the stomach. The liver and kidney are also the sites of waste products like the removal of carbon dioxide and synthesis of urine respectively.
Therefore, the skin and the Anus are sites where waste products are released from the body but not where they are produced.
To learn more about Excretion, refer to the link:
https://brainly.com/question/17097839
#SPJ2
Having dimples (D) is dominant over not having dimples (d). If a person that is Dd has children with a person that is dd, what would be their children’s possible genotypes?
a
DD, Dd
b
Dd, dd
c
dd, DD
d
Dd, DD, dd
Answer:
A or D
Explanation:
Dd, dd would be their children's possible genotypes. Therefore, option (B) is correct.
The genotype of the first parent is Dd, which means they have one dominant allele (D) and one recessive allele (d). The genotype of the second parent is dd, which means they have two copies of the recessive allele (d).
When these two individuals have children, each parent will randomly pass on one of their two alleles to their offspring. Therefore, the possible genotypes of their children are:
Dd (with a 50% chance): the child inherits the dominant D allele from the Dd parent and the recessive d allele from the dd parent.
dd (with a 50% chance): the child inherits the recessive d allele from both parents.
Therefore, the correct option is (b) Dd, dd. The children cannot have a DD genotype because the second parent does not carry the dominant D allele.
Learn more about genotype, here:
https://brainly.com/question/12116830
#SPJ5
HELP! ILL GIVE BRAINLIEST
Answer:
this is solar system
Explanation:
Make me as a brainlist
first up neap
second up spring
third neap
fourth speing
A cell has undergone determination to become an epithelial lung cell. If it is transplanted to a leg muscle, what do you think will happen to this cell?
Answer:
Change occur in form and structure of the cell.
Explanation:
The structure and shape of the cell change because the function of leg is different from the lungs. In the lungs the epithelial lung cell is responsible for the detection and protection of the cells against pathogen while on the other hand, the leg has the function to move an individual from one place to another so due to difference in function, the cells of both regions have different shape and structure of the cell and the epithelial lung cell will be changed into a leg muscle cell.
Because all of the cells in a multi-cellular organism come from a single cell, all of its cells will have the same number of
Answer:
Chromosomes
Explanation:
Multicellular organism are organisms that have more than one cells in their body. However, from the very beginning of every living organism including multicellular organisms, only ONE cell is required. In the case of multicellular organisms, this one cell undergoes division by mitosis to form other cells.
Since the cells divide by mitosis i.e 1 forms 2, 2 forms 4 etc.,. each of the cells are genetically identical to one another. Hence, this means that all the cells will contain the same number of chromosomes in their genome. For example, a dog as a multicellular organism has cells that emanate from one cell. If that one cell contain 39 chromosomes, all cells in the dog will also contain 39 chromosomes.
Be able to explain how segmentation and exoskeletons gave some animals an adaptive advantage over those that were not segmented and did not have exoskeletons.
Answer:
Arthropods have partially alleviated this problem by having the exoskeleton form as individual plates on each body segment or individual cylinders on each segment of the appendages. The plates are called sclerites, and they are connected by flexible tissue to allow the animal to bend during movement.Early land arthropods evolved adaptations such as book lungs or trachea to breathe air. The exoskeleton was another important adaptation. It prevents an animal from drying out. It also provides support in the absence of buoyant water.
HELP PLEASE THIS IS DUE TODAY.
BIOLOGY
Which is all of the organisms found on earth and all of the areas in which they live
A. Ecosystem
B. Biome
C. Species
D. Biosphere
Answer
ecosystem
Explanation:
because a biome is s a collection of plants and animals that have common characteristics for the environment they exist in. They can be found over a range of continents. Biomes are distinct biological communities that have formed in response to a shared physical climate.
Answer:
Biosphere
Explanation:
I took the test and got it right. Hope this helps!