are controlled by the genes made up of DNA located on the chromosomes. (thread-like strands) containing genetic material are located in the for the cell. The chromosomes is divided into small sections called The genes consist of a long strand of The DNA contains the blueprint for how the organism and functions (traits)

Answers

Answer 1

Answer:

Traits.

Explanation:

Traits in an organism are controlled by the genes. These genes are made up of DNA that is responsible for the unique appearance of the organisms. Some organisms are different from one another because of the DNA that helps the to perform different functions. In the DNA, all information is present about form and structure of the organisms so that's why we can say that traits or characteristics are controlled by genes.


Related Questions

PLEASE HELP! 20 POINTS!! Explain how genes relate to the presence of dominant and recessive traits

Answers

Answer:

Fires often remove alien plants that compete with native species for nutrients and space, and remove undergrowth, which allows sunlight to reach the forest floor, thereby supporting the growth of native species. ... Overall, fire is a catalyst for promoting biological diversity and healthy ecosystems.

Explanation:

What environmental factor in the soil affects the coloration of a hydrangea plant?

Answers

carbon dioxide and water

Which of the following describes positive feedback?
Select one:

A. A loss of output from the body’s receptors.

B. The response of the body to increased temperatures.

C. An event that reduces the effects of a stimulus.

D. An event that enhances the original stimulus.

Answers

C explaination: because you would be receive any bad effects

Select the true statements about mitosis and meiosis
Mitosis creates haploid cells
Mitosis creates cells with a complete set of genetic instructions
Meiosis create diploid cels
Meiosis creates cells with a complete set of genetic instructions
o Meiosis creates haploid cells
Mitosis creates diploid cells

Answers

Answer:

Mitosis creates cells with a complete set of genetic instructions, Meiosis creates haploid cells , Mitosis creates diploid cells

Explanation:

Someone please help meee ;-;

Answers

I don’t understand your question, can you go into more detail please
Dang that’s all the gave you no explanation

Review
Bookmark
DNA Unit Test (Spring 2021) / 19 of 29
What is most likely to result when a mutation affects a DNA sequence?
A. The codons will be unable to create bonds with the enzymes.
B. The nucleic acids will be unable to create bonds with the ribosomes.
C. The amino acid sequence will be changed and a different protein will be formed.
D. The protein sequence will be changed and a different set of nucleic acids will be formed.

Answers

Answer:it’s A

Explanation:

Which of the following describes positive feedback?

Select one:

A. A loss of output from the body’s receptors.

B. The response of the body to increased temperatures.

C. An event that reduces the effects of a stimulus.

D. An event that enhances the original stimulus.

Answers

B if I’m correct in not C is my second choice

How would I describe the movement of molecules, if I drop food coloring into a glass of water?

Answers

The coloring will separate, that’s how I would describe it

Please complete the following DNA strands

1. AGGTCCAAGCTCAAATTTCCCC

2. GAAACCCCTTAAACCTTAATTCC

3. GCGCGCGCAAATTTTTCCCATCT

Please complete the following strands using RNA:

1. AGGTCCCAAAGGCCCTTTCC

2. UAAAGGGCCCAGCCCACC

3. CUAAAAGGGGGUUUUAACC

Answers

1) TCCAGGTTCGAGTTTAAAGGGG
2) CTTTGGGGAATTTGGAATTAAGG
3) CGCGCGCGTTTAAAAAGGGTAGT

1) TCCUGGGTTTCCGGGUUUGG
2) AUUUCCCGGGUCGGGUGG
3) GAUUUUCCCCCAAAAUUGG
(Pretty sure)

Which statement accurately describes calories and Calories? A kilocalorie is equal to 1000 Calories. A kilocalorie is equal to 1000 Calories. A Calorie is equal to 100 calories. A Calorie is equal to 100 calories. A calorie is equal to 1000 Calories. A calorie is equal to 1000 Calories. A Calorie is equal to a kilocalorie. A Calorie is equal to a kilocalories.

Answers

Answer:

A kilocalorie is equal to 1000 Calories.

Explanation:

This is because 1000 calories make kilocalorie and it is the unit of energy in nutrition. It is the energy needed to raise temperature of 1 litre water to one centrigade or Celsius at sea level or is the amount of energy needed to cause increase of one degree Celsius of water.

In 1980, the __________ was passed to identify hazardous wastes and their life cycles.
A)
National Environmental Policy Act (NEPA)
B)
Resource Conservation and Recovery Act (RCRA)
C)
Integrated Waste Management ACT (IWMA)
D)
Americal Recovery and Reinvestment Act (ARRA)
E)
Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA)

Answers

Answer:

E

Explanation:

Right on Edg

Answer:

e.) CERCLA

Explanation:

CERCLA was passed in 1980 as a way to begin developing practices to handle and clean up hazardous wastes.

Which invertebrate from the picture did you choose from Figure 1? HINT: There is only 1 on there to choose.

Explain how body plan and anatomy enables your chosen invertebrate to perform the essential functions it needs to survive.

Answers

Answer:

Octopus (Behind the octopus's head, directly opposite the arms, is its mantle. The mantle is a highly muscled structure that houses all of the animal's organs. Its gills, hearts, digestive system and reproductive glands are all crammed into this one space)

Explanation:

I'll give brainliest

Has anyone done the 4.06 Enzymes Lab?

I don't need help on the lab part just the hypothesis.

I'm terrible at writing a hypothesis.
ACCESS 2021

Answers

Ok but what procedure are you doing then we can go off that to make a hypothesis

The starfish's water-vascular system is used for locomotion and capturing food. True/False

Answers

Answer:

true

Explanation:

What do the following membranes surround?

Answers

Answer:

the cell wall surroundnd the membrane

This Is for today help!!

Answers

First one passive. Second one active. Third active. Fourth is active. Fifth active. 6 is active. Just remember if it is against concentration gradient or requires any kind of energy or ATP it is active.
I don’t know just need to answer a few questions

How is carbon moving between the air and found it decreasing

Answers

Answer:

Animals and plants need to get rid of carbon dioxide gas through a process called respiration. Carbon moves from fossil fuels to the atmosphere when fuels are burned.

The oceans, and other bodies of water, absorb some carbon from the atmosphere. The carbon is dissolved into the water.

Explain how a concentration gradient, a membrane protein, and hydrogen ions work together to provide a mithochondrion with energy.

Answers

Answer:

Mitochondria within the electronic transport chain, are responsible for producing the energy that the cell needs, adjusting its operation to meet the metabolic needs of the body.The mitochondrion is the place where oxygen is consumed from aerobic organisms through various electron carriers and proton translocators (H +).

Explanation:

The lipid matrix of the membrane provides an impermeable barrier to ion translocation, as well as a topological organization to the catalysts in the membrane matrix that allows them to transport both e- and ions within and across the membrane in vector form. The transformation of oxidative energy into other forms of energy is carried out, initially, by generating a transmembrane electrochemical potential difference of H + ions (protomotive force). This force is the product of the asymmetric distribution of H + on both sides of the membrane, as those are translocated through it by the enzymatic complexes of the respiratory chain.The protomotive force is made up of two closely related components: one, function of the difference in chemical concentration of hydrogens across the membrane (a pH gradient) and another, dependent on the difference in electrical charge of H + ions on both sides of it (an electrical potential gradient). Gradients of electrical charge and chemical potential produce a field in which a force is exerted that tends to attract previously expelled protons into the mitochondria. It is the enzymatic complex of ATPase, the means by which the thermodynamically reversible translocation of H + ions is catalyzed. At the same time, the chemical activity of the H + on both sides of the membrane causes a change in the equilibrium constant of the enzyme, inducing it to catalyze the synthesis of ATP.

What is the major cause of changes in gene expression?

Answers


Genes encode proteins and proteins dictate cell function. Therefore, the thousands of genes expressed in a particular cell determine what that cell can do. Moreover, each step in the flow of information from DNA to RNA to protein provides the cell with a potential control point for self-regulating its functions by adjusting the amount and type of proteins it manufactures.

What might happen to a desert biome if the area received more rain than it normally receives over an extended period of time? Describe some of the changes that you might expect to see

Answers

Answer:

Desert biome will change.

Explanation:

Desert biome will change if the area received more rain than normal it receives over an long period of time because the vegetation on that area appears. The change in rainfall pattern in the desert area changes the animals present in this region because the temperature of the desert is no longer suitable for the desert animals so they migrated and other organisms come to this place.

1. If the DNA sequence of a gene
was TACTTACCGAGCTAGACT
then what is the sequence of the
messenger RNA?
-|

Answers

Answer:

ATGAATGGCTCGATCTGA or AUGAAUGGCUCGAUCUGA

Explanation:

A-T or U

G-C

C-G

T-A

The transcript of the gene that creates the protein is known as messenger RNA (mRNA). The transcription of the DNA sequence results in the production of mRNA.

What is the funda of the  DNA sequence and the mRNA sequence ?

The DNA sequence and the mRNA sequence are complementary, which means that the mRNA sequence is the DNA sequence's reverse complement. The nucleotides are organised in the 5'-3' orientation in the provided DNA sequence. The nucleotides must be read in the 3'–5' orientation in order to get the mRNA sequence.

As a result, the mRNA sequence is AGACTGCCATGAAGTT. Because the mRNA sequence is composed of the DNA sequence's complementary nucleotides, it is the reverse complement of the DNA sequence.

For instance, the DNA sequence's first nucleotide, T, and its complementary nucleotide, A, which is the This is the mRNA sequence's first nucleotide. The second nucleotide of the DNA sequence is A, while the second nucleotide of the mRNA sequence is U, which is complementary to A. The sequence is consistent with this pattern.  

Learn more about  mRNA  at :

https://brainly.com/question/29314591

#SPJ2

Crossing-over and nondisjunction take place during the process of
1.mitosis
2.meiosis
3.internal fertilization
4.binary fission

Someone help please and thank you

Answers

Answer:

2.meiosis............

Which of the following are sites where waste products are released from the body but not where they are produced
O skin and anus
O large intestine and small intestine
O liver and kidney
O tubules and ureters

Answers

Answer:

Its A skin and anus

(just did test)

Explanation:

The skin and the Anus are sites where waste products are released from the body but not where they are produced.

Which process of the human body eliminates the waste products?

Excretion is the biological process through which any unwanted or waste products are eliminated from the body.

Large and small intestines produce waste products that are not completely digested by the stomach. The liver and kidney are also the sites of waste products like the removal of carbon dioxide and synthesis of urine respectively.

Therefore, the skin and the Anus are sites where waste products are released from the body but not where they are produced.

To learn more about Excretion, refer to the link:

https://brainly.com/question/17097839

#SPJ2

Having dimples (D) is dominant over not having dimples (d). If a person that is Dd has children with a person that is dd, what would be their children’s possible genotypes?

a
DD, Dd
b
Dd, dd
c
dd, DD
d
Dd, DD, dd

Answers

Answer:

A or D

Explanation:

Dd, dd would be their children's possible genotypes. Therefore, option (B) is correct.


What is genotype?

The genotype of the first parent is Dd, which means they have one dominant allele (D) and one recessive allele (d). The genotype of the second parent is dd, which means they have two copies of the recessive allele (d).

When these two individuals have children, each parent will randomly pass on one of their two alleles to their offspring. Therefore, the possible genotypes of their children are:

Dd (with a 50% chance): the child inherits the dominant D allele from the Dd parent and the recessive d allele from the dd parent.

dd (with a 50% chance): the child inherits the recessive d allele from both parents.

Therefore, the correct option is (b) Dd, dd. The children cannot have a DD genotype because the second parent does not carry the dominant D allele.

Learn more about genotype, here:

https://brainly.com/question/12116830

#SPJ5

HELP! ILL GIVE BRAINLIEST

Answers

Answer:

this is solar system

Explanation:

Make me as a brainlist

first up neap

second up spring

third neap

fourth speing

A cell has undergone determination to become an epithelial lung cell. If it is transplanted to a leg muscle, what do you think will happen to this cell?

Answers

Answer:

Change occur in form and structure of the cell.

Explanation:

The structure and shape of the cell change because the function of leg is different from the lungs. In the lungs the epithelial lung cell is responsible for the detection and protection of the cells against pathogen while on the other hand, the leg has the function to move an individual from one place to another so due to difference in function, the cells of both regions have different shape and structure of the cell and the epithelial lung cell will be changed into a leg muscle cell.

Because all of the cells in a multi-cellular organism come from a single cell, all of its cells will have the same number of

Answers

Answer:

Chromosomes

Explanation:

Multicellular organism are organisms that have more than one cells in their body. However, from the very beginning of every living organism including multicellular organisms, only ONE cell is required. In the case of multicellular organisms, this one cell undergoes division by mitosis to form other cells.

Since the cells divide by mitosis i.e 1 forms 2, 2 forms 4 etc.,. each of the cells are genetically identical to one another. Hence, this means that all the cells will contain the same number of chromosomes in their genome. For example, a dog as a multicellular organism has cells that emanate from one cell. If that one cell contain 39 chromosomes, all cells in the dog will also contain 39 chromosomes.

Be able to explain how segmentation and exoskeletons gave some animals an adaptive advantage over those that were not segmented and did not have exoskeletons.

Answers

Answer:

Arthropods have partially alleviated this problem by having the exoskeleton form as individual plates on each body segment or individual cylinders on each segment of the appendages. The plates are called sclerites, and they are connected by flexible tissue to allow the animal to bend during movement.Early land arthropods evolved adaptations such as book lungs or trachea to breathe air. The exoskeleton was another important adaptation. It prevents an animal from drying out. It also provides support in the absence of buoyant water.

HELP PLEASE THIS IS DUE TODAY.
BIOLOGY

Answers

b is the answer i think but i’m sorry if it’s wrong i tried

Which is all of the organisms found on earth and all of the areas in which they live
A. Ecosystem
B. Biome
C. Species
D. Biosphere

Answers

Answer

ecosystem

Explanation:

because a biome is s a collection of plants and animals that have common characteristics for the environment they exist in. They can be found over a range of continents. Biomes are distinct biological communities that have formed in response to a shared physical climate.

Answer:

Biosphere

Explanation:

I took the test and got it right. Hope this helps!

Other Questions
Alma just received a 8% raise in salary. Before the raise, she was making $65,000 per year. How much more will Alma earn next year? One strategy U.S. manufacturers have employed in order to become more competitive isMultiple Choiceincreasing advertising budgets.creating technology foreign manufacturers depend on to increase effectiveness and efficiency.focusing on providing the lowest-priced products.maintaining a distance relationship with suppliers in an effort to guard trade secrets. There are 12 inches in 1 foot. Jada is working on improving her vertical jump. She records the measurements in feet and inches. Currently, her standing reach is 6 feet from the ground. The highest point of her jump is 108 inches. How many inches are in 6 feet?6 feet = 72 inches.Complete the statement to describe how to convert feet to inches. To find the number of inches, ? the number of feet by the unit rate, ? inches per foot. How do the organs of the excretory system work together to eliminate potentially harmful wastes from the body? Please choose A, B, C, or D Given that this conversation between Guy and Clarisse occurs just after his conversation with Mildred, the reader is naturally inclined to compare Mildred and Clarisse. How are Mildred and Clarrise similar and different? Use evidence from the text to support your response. HELP I WILL MARK BRAINLIEST The coordinate point E(8,-10) after a dilation with scale factor of 2.5, centered at the origin, becomes the point O (20,-25) O (16, -20) O (10.5, -7.5) O (5.5, -12,5 Chris borrowed $1,500 at a simple interest rate of 5% to buy a computer. He plans to have the loan paid back in 2.5 years. How much simple interest will Chris paywork needs to be shown Which new process for efficiency and rapid delivery to the market originated in Japan in the 1960s?Question 8 options:a) just-in-timeb) automationc) just-in-cased) right-to-work What would x equal( rounded to the nearest degree) Help me pleaseeeeee I need help Raelyn spent $6.00 on butterfly stickers for her bathroom wall. Each sticker cost 1/10 of a dollar. how many stickers did Raeyln but?From the same store,Beth biught 1/4 the number of butterfly stickers Raeyln bought.How many butterfly stickers did Beth buy? HELP PLEASE YEAH YEAH HERE IS THE IMAGE Which method can be used to calculate the percentage composition of acompound? Please answer bro I need. This now the side of the clip board appears to be a right triangle . the leg length are 2 millimeters and 2.1 millimeters and the hypotenuse is 2.9 millimeters. is the thee of the clip a right triangle ? PLEASE HELP, ILL MARK BRAINLIEST""solve triangle ABC using the given information round triangle measures to the nearest degree and side measure to the nearest tenth Popular petitions in history What could be the first step in simplifying the equation below? 5x + 3 = 25x - 7 O Add 5x to both sides O Subtract 5x from both sides O Add 3 to both sidesO Subtract 7 from both sides