(Apoptosis is? ) A)cancerous cells
B)programmed cell death
C)non-dividing cells
D)Part of the kinase/cyclin cascade

Answers

Answer 1
Apoptosis is programmed cell death. The body is this to get rid of unneeded or abnormal. The body will get rid of cells with damaged DNA before they can become cancerous.
Answer 2

Answer:

B

Explanation:

death of a cell which occurs as a normal and controlled part of an organisms growth


Related Questions

When the northern hemisphere points toward the sun, the southern hemisphere faces away from the sun. In this instance, it is:

A.
summer in North America, and winter in Australia.
B.
summer in North America and Australia.
C.
winter in North America, and summer in Australia.

Answers

Answer:

A

Explanation:

the northern hemisphere is the opposite from the southern hemisphere

Since northern and southern hemisphere are in opposite directions therefore, option (A) is correct.

Why are the seasons reversed in each hemisphere?

The axis of rotation of the Earth is inclined with regard to the plane in which it orbits the sun. This is the root reason of the changing of the seasons. When the axis of the earth is aligned with the sun, summer arrives in that hemisphere of the planet. Expect winter to arrive when the axis of the earth is tilted away from the sun.

Different places of Earth receive the Sun's most direct rays throughout the year. When the North Pole tilts toward the Sun, it's summer in the Northern Hemisphere. When the South Pole tilts toward the Sun, the Northern Hemisphere experiences winter.

Learn more about seasons, here:

https://brainly.com/question/12028829

#SPJ2

PLEASE HELP ME - In 1839, Schleiden and Schwann began formulating a theory of cells and their role in living organisms. Over time, cell theory has been updated. Modern theory is summarized below. All known living things are made up of cells. The cell is the structural and functional unit of all living things. All cells come from pre-existing cells by division. The flow of energy occurs within cells. Cell theory explains all of the following except a. the growth of animals. b. how viruses require the cells of living organisms to survive. c. how bacteria reproduce. d. the storage of chemical energy in plant cells.​

Answers

It made it possible to actually see cells. Explanation: With the development and improvement of the light microscope, the theory created by Sir Robert Hooke that organisms would be made of cells was confirmed as scientist were able to actually see cells in tissues placed under the microscope.

Thank You so Much

your amazing have a great life

1. Carbon is a very important element in biology. What are some of the reasons that organisms need carbon? please help me

Answers

Answer:

"All living orgasms contain carbon and all virtual molecules in the body contain carbon, sugar, DNA, proteins, Fats..."

Explanation:

Hope this helps :)

A molecule of oxygen gas contains two:
O molecules
O elements
O atoms

Answers

Answer:

O atoms

Explanation:

:)))

A molecule of oxygen gas contains two atoms of oxygen bonded together.

Answer: your answer will be C

How could one determine if two
unidentified organisms share a common
ancestor?

Answers

Answer:

Evolutionists determine that two organisms have a common ancestor is by looking at fossil evidence in different rock layers using the law of Superposition (Oldest layers are on the bottom, newest are on the top) and compare the skulls or other bones to each other in order of oldest to newest (or newest to oldest). Another way to determine this is to examine the amount of DNA a certain species shares with another species. An example of this would be that Humans share roughly 90% of our DNA with chimpanzees or the other Great Apes.

Explanation:

DNA

They can look at the DNA it's the most common one.

There are 4 pieces of evolution and they are

Fossils , Geography , Embryos / DNA , Anatomy

Fossils: Physical remains of species , Determine age, location,  environment

Deeper layers = older

Geography: Proves species share common  ancestors, depending on where

they live

DNA: BEST evidence because it’s the  MOST ACCURATE

Similarities in the early stages of  development

Similarities in DNA

More similarities = closely related

More differences = not related

Anatomy: Compare body parts of different  species to see how they evolved

3 different structures:

Homologous (same structure,  different function)

Analogous (similar structure,  different organisms)

Vestigial (body parts that no  longer serve a purpose)

All of that are in evolution

Hope it helped! ( Gave u my biology notes :D)

which layer of the earth is made out of melted metal?

Answers

The outer core. A molten nickle- iron alloy.

What are 3 lines of evidence that corroborate the theory of evolution?

Answers

Answer:

Lines of Evidence supporting theory of evolution by natural selection: Fossil evidence, Biographical evidence and Anatomical evidence.

Explanation:

I majored in Biology

What biotic factors might affect a population of fish? Check ALL that apply.

predators
prey
light
bacteria

Answers

Answer:

Explanation: Abiotic factors for fish is water, temperature, amount of dissolved oxygen in water, etc. Penetration of sunlight is also important in fresh water habitat. Biotic factors are predators, disease causing organisms, organisms available as food, population density of competitors, etc.

Explanation:

1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:

Answers

Answer:
mRNA: UAUGCUUUAGCGCUAGCGCCGCUAAGCC

CODONS: AUG-GAA-AUG

AMINO ACIDS: METHIONINE-LEUCINE


Explanation: hope this helps
i am so confused is this an actual question or is it just random letters?-

what is reduced soil?

Answers

Answer:

A chain of reactions is initiated upon soil flooding leading to reduced (low) soil redox potential (Eh, mV) conditions. These reactions include physical, chemical and biological processes that have significant implications for wetland plants.


Physical processes include restriction of atmospheric gas diffusion in the soil leading to depletion of soil oxygen and accumulation of carbon dioxide [4,5]. ... This process leads to oxygen depletion and reduction in soil oxidation reduction potential (Eh) followed by a chain of soil chemical changes.

The formation of an ionic bond involves the
Select one:
O sharing of neutrons.
sharing of protons.
transfer of neutrons
transfer of electrons

Answers

Answer: transfer of electrons

Explanation:

Which are the following statements are TRUE when concerning cells?
A: Prokaryotic cells can only produce eukaryotic cells
B:All cells come from pre-existing cells
C:Cells must always reproduce with other cells

D:Plant cells can only reproduce with animal cells

Answers

Answer:

I think it will option b hope it helps

how does the respiratory and digestive system work together to maintain homeostasis

Answers

You have four main types of tissues: epithelial, nervous, muscle, and connective tissue. Epithelial tissue covers the outside of the body. It also lines organs and cavities. Nervous tissue sends electrical signals. Muscle tissue helps you move. Connective tissue joins bones and cushions organs.
When groups of tissues work together, they are called organs. Some
examples of organs are the heart, lungs, skin, and stomach. When organs work together, they are called systems. For example, your heart, lungs, blood, and blood vessels work together. They make up the circulatory system.
There are eleven systems in the human body: muscular system, respiratory system, digestive system, integumentary system (skin), skeletal system, circulatory (or cardiovascular) system, excretory (or urinary) system, reproductive system, nervous system, lymphatic system, and endocrine system. Each system has a special job.
All of your body systems have to work together to keep you healthy. Your bones and muscles work together to support and move your body. Your respiratory system takes in oxygen from the air. It also gets rid of carbon dioxide.
1
2
3
4
5
6
Your digestive system absorbs water and nutrients from the food you eat.
Your circulatory system carries oxygen, water, and nutrients to cells throughout your body. Wastes from the cells are eliminated by your respiratory system, your excretory system, and your skin. Your nervous system controls all these activities with electrical impulses. If any system in your body isn't working properly, other systems are affected.
Think of your body as a building. A building has a plumbing system, a heating system, a cooling system, an electrical system, and a support system. If any system in a building breaks down, other systems can be affected.
As one example, think about a building's electrical system. Suppose a mouse chewed through an electrical wire to a furnace. Without electricity, the heating system would not work. If this happened in very cold weather, the plumbing system could be affected. Water pipes might freeze and burst. If a lot of water leaked into the building's walls, its support system would be damaged. Like a building's systems, your body's systems have to work together.
HERE IS UR ANSWER MATE!.....

The respiratory system brings oxygen into the lungs when you breathe. The digestive system breaks food down into nutrients such as glucose. Now the circulatory system enters the picture. It transports glucose and other nutrients from the digestive system to the cells.

HOPE IT HLPS UH WELL

correct order of events during the process of nucleosynthesis?

Answers

Answer:

hydrogen nucleus formed, isotope of hydrogen, tritium formed, helium nucleus formed

Explanation:

Answer:

A

Explanation:

took the quiz

You are working in a lab trying to identify a single celled organism. You are not
sure if it is a Protist or a Moneran (Eubacteria or Archaebacteria). What test
would be most useful to determine its identity?
A. Put it in the sun and measure the oxygen levels
B. Determine if it is motile
C. Test its cells for chitin
D. Determine if it has a nucleus

Answers

The test that will be most useful to determine the identity of the single-celled organism is to "determine if it has a nucleus".

DIFFERENCE BETWEEN A PROTIST AND MONERAN:

A protist is a member of the kingdom protista characterized by it's single cells and eukaryotic nature.

On the other hand, a MONERAN is a member of the kingdom MONERA and characterized by it's unicellular and prokaryotic nature.

The major difference between Monera and protista is their prokaryotic and eukaryotic cells respectively. Prokaryotic cells do not have a membrane bound nucleus while an eukaryotic cell does.

Since the major difference between Monerans and protists is their possession of a membrane bound nucleus, the identity of the single-celled organism is to "determine if it has a nucleus".

Learn more: https://brainly.com/question/5144655

Which of the following processes cycles matter through different parts of an ecosystem?
More than one answer may be correct.
1. the nitrogen cycle
2. the water cycle
3. the carbon cycle

Answers

Answer:

the nitrogen cycle, the water cycle, and the carbon cycle

Explanation:

The water, carbon, and nitrogen cycles move nutrients through the different parts of an ecosystem. Water moves through organisms and the environment in different phases. Carbon moves through an ecosystem in carbon dioxide, minerals, and organic compounds. Nitrogen moves through an ecosystem in nitrogen gas, ammonium, nitrates, and organic compounds.

The biogeochemical cycle is a pathway that circulates the chemicals through the abiotic and the biotic factor. The nitrogen, water, and carbon cycle through various regions of an ecosystem.

What is a biogeochemical cycle?

The biogeochemical cycle is the movement of the chemicals and compounds of carbon, nitrogen, and water in the biosphere (biotic) and the atmosphere, lithosphere, and hydrosphere (abiotic) spheres of the earth.

These cycles move the nutrient through different spheres in the form of inorganic and organic compounds. It is an essential part of the ecosystem as they regulate the flow of the natural elements.

Therefore, option 1. nitrogen cycle, option 2. water cycle, and option 3. carbon cycle move through various parts of an ecosystem.

Learn more about biogeochemical cycles here:

https://brainly.com/question/1204069

#SPJ2

What is the phase change from gas to liquid?
A. Sublimation
B. Condensation
C. Vaporization
D. Transpiration

Answers

Answer:

Condensation

Explanation:

Condensation is the phase change from gas to liquid. For example, water vapor condenses when you are taking a shower because wet spots show up on a mirror after taking a shower.

Answer:

Condensation

Explanation:

Sublimation is when a solid turns into a gas. Condensation is when water in the air collects to form droplets that gather on a surface/object. Vaporization is when a liquid forms into a gas. Transpiration is a thing in plants where water transfers throughout the plant.

What two elements of weather are affected by air masses

Answers

Answer:

The air masses separated by a front usually differ in temperature and humidity. Cold fronts may feature narrow bands of thunderstorms and severe weather, and may on occasion be preceded by squall lines or dry lines. Warm fronts are usually preceded by stratiform precipitation and fog.

Cold fronts and warm fronts

NEED HELP WITH THESE 4 QUESTIONS WILL GIVE BRAINLIST!!!
1.What were some characteristics that the finches developed to give them an advantage in surviving?

2.How do you think that the one species of finch evolved into many different species, each with its own advantages?

3. In what ways do these advantages help the finches to survive and reproduce?

4. What might have happened if the finches didn't evolve into many different species?

Answers

Answer:

1. Because the drought reduced the number of seeds and finches with bigger beaks were able to eat the larger and harder seeds so more of them survived.

2. Summary: Changes in the size and form of the beak have enabled different species to utilize different food resources such as insects, seeds, nectar from cactus flowers as well as blood from iguanas, all driven by Darwinian selection

3.  Medium ground finches with larger beaks could take advantage of alternate food

4. three species of Darwin's tree finches have been known to inhabit Floreana  but no birds singing that song on Floreana have been heard in many years.

Explanation:

Are gender traits completely a result of societal expectations?

Answers

Answer:

No. Gender traits in humans are largely determined by biophysical processes. There seems to be a vocal political faction that is trying to convince people in the name of liberty and equality that gender traits are completely learned, and therefore arbitrary. But this claim disagrees with scientific evidence. In general, boys play more with cars and girls play more with dolls not because their parents are perpetuating outdated gender stereotypes, but because their brain is telling them to. This fact does not mean that boys have to play with boy toys, or that boys who play with dolls aren't really boys. It is just a scientific observation about average behavior and its link to fetal development.

When is carbon dioxide released during aerobic cellular respiration?

Answers

Answer:

I hope this helps and rate it if its right

Explanation:

I hope this helps and rate it if its right

how do vital signs allow medical professionals to assess a patient's physiology and overall health

Answers

they measure the pulse rate and blood pressure of a patient, these can  help to determine if a patient has any diseases of the blood or if they are under stress.

Can someone help me thank you!!

Answers

Answer:

CARBON

Explanation:

How does the size of a bacterial cell compare with an animal cell?

Answers

Answer:

hope it helped

Explanation:

Bacterial cells are very small - about 10 times smaller than most plant and animal cells. Most bacterial cells range in size from 0.2 to 10 microns or micrometers (0.0000079 to 0.00039 inches). ... One reason why bacterial cells are so small is that they need a large surface area to cell volume to take in nutrients.

Answer this please I promise 30 points + mark as brainliest ( only relevant answers )

Answers

Answer:

A) Group X = Rose ,mango tree,marigold,palm tree

B) This is the answer of group X =Rose ,mango

This is the answer of group Y =Fern ,pine trees

Explanation:

Answer:

jen, from my heart im saying i lu.v u for real

its been almost 5 months weren't having the same old c.hat we used to have.

ik that ur scared to c.hat with  me since the day ur mom caught u

but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u

and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could

i'll be waiting for that moment and i hope u would be too...

still lu.v u :(  .......

Need help. brainliy to the first person that answers is right telling why

Answers

I am pretty sure it's A because tectonic plates coloring causes a mountain like shape and would bend the rock.

What happens to the cells at the edges of an injury when a cut in the skin or a break in a
bone occurs?

Answers

Explanation:

[tex]\huge{\underbrace{\overbrace{\mathfrak{\blue{Answer:}}}}}[/tex]

When an injury such as a cut in the skin or a break in a bone occurs, cells at the edges of the injury are stimulated to divide rapidly. This action produces new cells, starting the process of healing.

Pls I need answers at least one answer of any of the questions

Answers

Have you ever wondered how many times your heart beats in a day, a month, a year—or will beat in total throughout your life? Over an average lifetime, the human heart beats more than 2.5 billion times. For a person to keep their heart healthy, they should eat right, not smoke and get regular exercise. In this science activity, you'll measure your heart rate during different types of physical activities to find out which gives your heart the best workout to help keep it fit.
Background
A 150-pound adult has about 5.5 liters of blood on average, which the heart circulates about three times every minute. A person's heart is continuously beating to keep the blood circulating. Heart health experts say that the best ways to keep our hearts healthy is through a balanced diet, avoiding smoking and regular exercise.

How do adaptations lead to change?

Answers

In evolutionary theory, adaptation is the biological mechanism by which organisms adjust to new environments

What is inheritance in biology

Answers

Answer:

passing of traits

Explanation:

Inheritance is the act of passing traits through sexual or asexual reproduction.

Other Questions
pls help will give brainisest. Find the length of A. Describe five ways that you can stay safe when you photograph The length of a room is 7.25 feet longer than the width, x, of the room. Which expression represents the perimeter of the room? What opinion did the United States government have towards Native Americans during the Manifest Destiny era? Name two examples of poor treatment of Native Americans at the hands of the U.S. Government. What is the sum (-19X10) + 7 1. The distance (d) from the center of the seesaw varies inversely as the weight (w) of a person.JB who weighs 50 kg sits 3 feet from the fulcrum. How far from the fulcrum must JP sit in order tobalance with JB if he weighs 35 kg?2. The number of pages (p) that Ethan reads varies directly as the number of hours (1) he isreading.A. write the variation equationB. If he can read 21 pages in 14 minutes, how many pages can he read in 21 minutes?3. The pressure of the gas is directly proportional to the temperature and inversely proportional toits volume.A. Write the variation equation.B. What will happen to the pressure if the volume is reduced to half and the temperature isdoubled?4. Given the equation y = k ma, where k is the constant of variation, which of the followingstatements are TRUE or FALSE.A. y and r varies directly.B.y and q are directly proportionalC.y and pq2 varies jointlyD. p and r are inversely proportionalE. y and p varies directly.pasagot naman mga prii What is always true about the light ray that emerges from the right side of the lens? I need number 7 and 8 answered please help me!! will mark brainliest Level 3: A plumber charges $50 for a service call plus $75 per hour of service. What will be the total cost for 8 hours of work? *$650$600$475$400 The height of a triangle is 6 units less than twice the base length if the height is 18 units, what is the base length Which statement best compares a traditional economy and a command economy?A. Economic decisions are based on tradition and culture in a traditional economy, while trade is limited to barter in a command economy.B. Individuals have little control of economic decisions in a traditional economy, while the government owns all of the resources in a command economy.C. Methods for farming, hunting, and gathering change little over time in a traditional economy, while there is no competition to produce goods and services in a command economy.D. Economic decisions are made by the government in a traditional economy, while the government sets the prices of goods and services and distributes them in a command economy. PLEASE DON'T JUST WRITE AN ANSWER!!! I WOULD REALLY APPRECIATE A STEP BY STEP EXPLANATION SO I CAN UNDERSTAND IT MYSELF :)) Which word describes the movement of the ancient Hebrews from Egypt to settle in theirnew homeland?A) HajjB) ExodusC) BabylonD) Sabbath is the gap store an example of commercial construction? Yes or no What are three ways a seed can be taken from one place to another? Which is rightThe last thing I bought is a dress.The last thing I bought was a dress. People in the Middle Ages were beginning to question:DramaAuthorityScientists (-1,-4) and (3, -4) slope intercept equation 2. Create a complementarystrand of DNA for theDNA strand show below.A T C G T G A