HomeworkHive
Home
Search
Login
Search
Home
Engineering
Americans Spent Approximately __ Cents Of Each Dollar On The Purchase Of Energy?
Engineering
College
Americans spent approximately __ cents of each dollar on the purchase of energy?
Answers
Answer 1
Answer:
14 cents
Explanation:
1 trillion US dollar
Related Questions
Other Questions
PLS ANSWER ASAP. ILL GIVE BRAINLIEST! Match the system for each of the following bodily organs.1.Nose a. Skeletal System2.Skull b. Circulatory System3.Kidneys c. Urinary System4.Veins d. Respiratory System
plz help timed MATHHHH 12 pointes
Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :)
Select one of the readings in this unit, EXCEPT the Gettysburg Address, and in at least 150 words, discuss the historical context or cultural context the author demonstrates.
How did Tisquantum help the Pilgrims????i will give brainliest and extra points
Find the value of x in the image
Read and choose the option with the regular verb in the imperfect tense.La princesa ley el libro.El rey no hablaba.La reina fue a la torre.El prncipe tom caf,
Do you believe that parents should have all of the powers described in the Parents Constitution? Why or why not?
How does the setting influence the theme of the story (pieces in the past ) story 15 points
kareem drew a diagram to compare flatworms and segmented worms which label belongs in the area marked X?a. can reproduce sexuallyb. are always parasites c. are all sessiled. are covered in setaePLEASE HELP
Someone pls help me with both :(
An ant bed contains about 230 ants. If there are 6 of these beds on the playground, how many ants are there?
What was an effect of the Teapot Dome scandal?A. It increased public support for U.S. membership in the League ofNations.B. It increased public support for signing the Treaty of Versailles.O C. It resulted in laws passed by Congress to reform federal elections.D. It confirmed public concerns about relationships betweenbusiness and the Harding administration.
Can yiu ANSWER ALL OF THEESE QUESTIONS :1.Its cost $10.00 for 20 oranges. Is $2.00 per orange accurate? 2.Find the unit rate for 5 cans of chicken soup that cost a total of $2.00.
11. Cheetahs have been through a genetic bottleneck; evidence for this is thatA little natural selection occurs in this species.B. the body is long thin, and graceful.c. there is very little genetic variability.D. these cats are members of an endangered species.E. they originally came from sm all areas of Africa.
What is the x-coordinate of the point shown in the graph?y84-22 24B-8-6-4-2-24
A. they occurred before because the end of the Ptolemaic dynasty corresponds to the birth of Christ B. they occurred after because BCE is an abbreviation that translates to in the year of our lord C. they occurred before because BCE is the same time period as BCE which means before Christ D. they occurred after because the Egyptian old kingdom marks the beginning of the common era
What is the square root of -16?
white and informative essay about why or why not wearing school uniforms would be beneficial to students and school district
HELP ASAP!!Which of the following depicts early city life?Running water was a great benefit.There was a remendous lack of space.It was very inexpensive to live in the city.City life made one feel independent.