Although he can join the military at 17, what is Lucius not trusted to do until he is 25 years old

Answers

Answer 1

Answer:

He's not trusted to arrange business deals. His father will take care of that until he is 25

Explanation:

Fathers and uncles take the kids to the Forum Augustus to see statues of Rome's famous warriors like Aeneas, who led Rome's ancestors, the Trojans, to Italy.


Related Questions

does anyone have cheez its they can mail to me

Answers

They are delicioussss
Cheez it’s make my throat dry

Fill in the blanks with the correct helping verb and past participle form of the main verband
der Patient ______ein neues Rezept (bekommen)______
hat, bekommen
ist, bekommen
wird, bekommen
sen bekommen ​

Answers

Answer:

i know im like half a year away from answering ths but sorry to say i dont know a god dang thing you just put

Explanation:

Welche waren oder sind seltsame Angewohnheiten genialer Menschen?

Answers

Answer:

A strange habit of some brilliant people is that they have a very good memory.

Answer:

Kritzeln und Tagträumen sind Gewohnheiten intelligenter Menschen

Explanation:

Other Questions
what is the role of the grana in chloroplast? Which of the following will NOT help reduce the costs of car ownership? A. Carpooling and safe driving B. Performing maintenance tasks on your own C. Speeding D. All of the above A school has 617 students. Each class has between 28 and 32 students. Which is the best estimate of the number of classes in the school?14 classes20 classes30 classes60 classes Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT GMMThe numbers are36XAnd 46 degrees QUESTION 10 of 10: You have a need to purchase 30 units of a product and have them delivered to your company in five days. The sale price is $35 each. Sales tax on the product is 8%. Shipping price is $15. But there is also a 25% rush charge on the sales price added for deliveries less than seven days, which is also taxable. What will be the total cost of this purchase? O a) $1,050.00 b) $1,327.50 Oc) $1,396.50 O d) $1,432.50 plz help i need help im failing Simplify as far as possible.182 I walked into that reading room a happy healthy man. I crawled out a decrepit wreck Complete each statement by choosing the correct family member that best fits the description.Select the correct answer from each drop-down menu.El padre de mi padre es miEl hijo de mi ta es miLa madre de mi madre es mivEl hijo de mi padre es miLa hija de mi to es mi Who are the most aggressive of the types we looked at? what's the pagathorium theorem A power pole 10 m tall casts a shadow 8 meters long, at the same time that a building nearby casts a shadow 14 m long. How tall is the building? A tank containing oxygen, carbon dioxide, and nitrogen gases has a total pressure of 6.7atm. If the O2 has a pressure of 3.0 atm and the carbon dioxide has a pressure of 1.2what is the partial pressure of the nitrogen gas? The movement of water in or out of the cell membrane without the use of ATP.Diffusion Facilitated diffusion OsmosisExcoytosis Escoger Circle the item that does not belong.1.c. la papelera Ca. la tizab. la pluma2.a. la geografac. la economab. el libroB3.a. la mochilab. la puertac. la ventana4.a. la residencia estudiantilb. la casac. la tarea5.a. la pizarrab. el trimestrec. el mapa6.a. el inglsb. el espaolc. el arte A cube with a volume of 75 cm is dilated bya factor of 5.What is the volume of the dilated cube?Enter yOur answer in the boxcm In his Farewell Address, Washington shared his feelings about the US and foreign diplomacy. He believed inA - neither trade or political involvement B - both trade and political involvement C - political involvement with foreign countries,but no tradeD - trade with foreign countries, but no political involvement 2x + y = 7 3x -2y = -7 solve by substitution *last question I need help with* SOLVE FOR X. PLEASEEE HELP ME ASAP!!!! thank you!! *will give brainliest*