All planets in the solar system have surfaces that are made up of either one of two materials. What are the two materials?

Answers

Answer 1

Answer:

are made of rock, containing common minerals like feldspars and metals like magnesium and aluminum.

Explanation:


Related Questions

Write any three differences between mass and weight


please its aurgent fast ​

Answers

Answer:

See explanation

Explanation:

There are a number of differences between mass and weight, they include;

Mass is  a scalar quantity whereas weight is a vector quantity.

Mass is dependent on the quantity of matter present in a body whereas weight depends on the acceleration due to gravity in a particular location on the earths surface.

The SI unit of mass is kilogram whereas the SI unit of weight is Newton.

what were some of the earliest life forms? and what were they like

Answers

The earliest forms of life were microorganisms. These organisms appeared about 3.77 billion years ago.

1. What is the pH range for an acid?

A. 0 - 7- 14



2. What is the pH range for a base

A. 0 - 7- 14



3. What are the products of an acid base reaction?

A. water and salt

B. acid and base

C. water and sugar

D. water



4. What substance has a neutral pH?

A. ammonia

B. water

C. sodium bicarbonate

D. vinegar



5. The negative ion found in bases is the ______________

A. hydrogen ion (H+)

B. hydroxide ion (OH-)

Answers

Answer:

0-7-14

0-7-12

c is correct water and suger

d is correct vinegar

b is correct (OH-)

Can someone please help me I don't understand the and my parents don't under please

Answers

432hz x 432hz = 2228

Explanation:

the simple explanation is shushh

what direction was the texas annexation in?

Answers

They faced washington DC

What process in humans is a good representation of asexual reproduction?

A. Meiosis

B. Mitosis

C.Fertilization

Answers

Answer:

B.

Explanation:

What are the three main classifications that describe galaxies? By what one visible
characteristic do scientists categorize galaxies?

Answers

Answer:

Spiral Galaxies, Elliptical Galaxies  & Irregular Galaxies

Explanation:

How did galaxies originate? Astronomers believe that after the big bang, the explosion which began the universe 10 billion to 20 billion years ago, gravity began to compress masses of free-floating gas. Two main theories, bottom-up and top-down, explain what happened next. According to bottom-up theories, clusters began to form and assembled together into the larger units we know as galaxies. Top-down theories suggest that galaxies formed first, and the stars and other objects within them were subsequently produced. They categorized different galaxies to maintain their tests from the other galaxies.

What environment does ambulocetus live in?

Answers

Answer:

northern Pakistan, in long-lost coastal shallow seas and brackish rivers

Explanation:

i'm hoping this is right

Answer 15 and 16 correctly and I will mark as brainliest

Answers

Answer:

I think its A and G

Answer:

15. B.

16. H

Explanation:

What is a constant?
O a variable
a number that stands alone with no variable
O the number in front of the variable
O two terms that look exactly the same


need help please

Answers

Answer:

a number that stands alone with no variable

Hope this helps!

Identity Factors in an Experiment
WARM-UP
Consider what you already know about scientific design. To set up an experiment testing whether
students' grades are affected by their level of exercise, which factors do you think you would need to keep
in mind? Check all that apply.
student gender
vpe of exercise
amount of exercise
what grades are measured
how long the experiment will last
what time of day the students exercise
how much time the students spend studying
DONI

Answers

Answer:

Did you copy and paste this from somewhere because i want to help but i don't understand it at all.

Explanation:

When covalent bonds form. the amount of energy present decreases. What happens to the stability of the atoms in the bond?

Answers

Covalent bonding occurs when pairs of electrons are shared by atoms. Atoms will covalently bond with other atoms in order to gain more stability, which is gained by forming a full electron shell. By sharing their outer most (valence) electrons, atoms can fill up their outer electron shell and gain stability.

MULTIPLE CHOICE QUESTION
Why do scientists think that cuttlefish
have the biggest brain to body ratio of all
invertebrates (animals without a spine)?

Answers

Answer:

Due to its high intelligence.

Explanation:

Scientists think that cuttlefish  have the biggest brain to body ratio of all  invertebrates that allows it to sense sight, smell, and sound that comes to it in the form of pressure waves. Due to this big brain, cuttlefish are very intelligent so due to its intelligence the scientists thinks that cuttlefish has the biggest brain as compared to other big vertebrates such as octopus.

explain how the equilibrium price is determined​

Answers

Answer:

The equilibrium price is the price at which the quantity demanded equals the quantity supplied. It is determined by the intersection of the demand and supply curves. .

A decrease in demand will cause the equilibrium price to fall; quantity supplied will decrease.

Explanation:

explain in details the mechanism of transportation in plants​

Answers

Answer:

Plant transport systems move energy from leaves and raw materials from roots to all their parts. The xylem (tissue) moves water and minerals obtained from the soil to all other parts of the plants.

Explanation:

I hope I helped:)

Electron transport from complex I to complex IV pumps more protons than transport from complex II to complex IV.
With this in mind, which will produce more ATP

A. Transport from complex I produces more ATP.

B. Transport from complex II produces more ATP.

C. Both produce the same amount of ATP.

Answers

Answer:

A

Explanation:

ATP synthase uses a proton gradient to make ATP. Since transport from complex I creates a larger proton gradient, it also produces more ATP.

Electron transport from complex I produces more ATP.

ELECTRON TRANSPORT CHAIN:

The electron transport chain, ETC, is the third and last stage of aerobic cellular respiration. It produces the highest molecules of ATP in cellular respiration.

The ETC involves the transfer of electrons to series of molecules in order to create an electrochemical gradient needed for ATP synthesis.

The electron transport chain is made up of four complexes namely: Complex I, II, III and IV. NADH and FADH2 produced in the Krebs cycle are the electron carriers.

Complex I pumps more hydrogen ions (H+) from the mitochondrial matrix to the intermembrane space.

Since the pumped is directly related to the number of ATP molecules, complex I will produce more ATP molecules.

Learn more: https://brainly.com/question/442662?referrer=searchResults

What is the definition of a DNA Polymerase

A. Enzyme involved in DNA replication that joins individual nucleotides to produce a DNA molecule
B. An enzyme that unwinds the DNA double helix during DNA replication
C. A class of nucleotides that includes adenine and guanine.
D. A bond between complimentary base pairs in DNA​

Answers

A. I hope this hopes

Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D

Answers

Answer:

C

Explanation:

it has the example figure number 7 and also it has the correct bisector

which is NOT part of the cell theory?

A) all living thing a are composed of cells
B) Cells are the building blocks of germs
C) All cells come from other cells
D) Cells are the basic units of structure and function in living things

Answers

Answer:

B.

Explanation: Hope this helps! ^^

when an experiment shows that two variable are closely related the experiment shows what

Answers

Answer:When an experiment shows that two variables are closely related, the experiment shows correlation between the two variables. Correlation helps to show how two variables are related and connected. Related variables are said to be correlated. For example, we can say, good health is correlated to daily exercise routine.

Explanation:

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

please help
Explain how an organ and organelles are related

Answers

Answer:

Just as organs are separate body parts that perform certain functions in the human body, organelles are microscopic sub-units that perform specific functions within individual cells. Organelles are specialized structures that perform various jobs inside cells.

Organelles are microscopic subunits that carry out certain tasks within individual cells, whereas organs are distinct body sections that carry out specialized tasks for the human body.

What is the relation between organ and organelles?

Literally, the phrase refers to “tiny organs.” Organelles provide specialized functions to keep a cell alive, much like organs like the heart, liver, stomach, and kidneys serve specific functions to keep an individual alive.

Atoms, molecules, organelles, cells, tissues, organs, organ systems, and the human organism are the major levels of organization in the body, going from the simplest to the most complex.

Like an organ in the body, an organelle is a subcellular structure that performs one or more particular functions for the cell.

Therefore, organ and organelles differ in their functioning.

Learn more about organ and organelles here:

https://brainly.com/question/22911736

#SPJ2

The function of mitochondria and chloroplasts is related to energy. In what way does their function differ?
A.
Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells.
B.
Mitochondria produce energy from food, while chloroplasts produce food from the Sun’s energy.
C.
In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green.
D.
Mitochondria provide energy in the night, while chloroplasts provide energy in the day.
E.
Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Answers

Answer:

The answer is option E- Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Explanation:

It’s E the answer is E mitochondria provide energy from food synthesized by organelles other than chloroplasts while chloroplasts provide energy through photosynthesis using the sun’s energy

Look at the graph below. A graph is shown with Absolute magnitude shown on y axis and Surface temperature in degree Celsius shown on x axis. The Dwarf stars are shown along a slanting line from coordinates 30,000 and minus 3 to 10,000 and minus 4. The Main Sequence stars are shown along a slanting line from coordinates 20,000 and minus 2 to 2,000 and minus 6. The giants are shown along a line parallel to the x axis from coordinates 5,000 and 2 to 2,000 and 3. The supergiants are shown along a line parallel to the x axis from coordinates 7,500 and 4 to 2,500 and 4. Point A has coordinates 20,000 and minus 4. Point B has coordinates 2,500 and minus 4. Point C has coordinates 5,000 and 2. Point D has coordinates 7,000 and 4. Which of the following stars is most likely to be red? Star A Star B Star C Star D

Answers

Answer:

Star A

Explanation:

If you look directly at the diagram, the dwarf stars are labeled under 'A' and are the least in mass and temperature.

Being the smallest and coldest, dwarf stars most commonly have red coloration, which would make them the obvious choice.

Star A which is a dwarf star has the coldest temperature, and therefore is a red star since red stars are the coldest stars.

What are stars?

Stars are a large self-luminous bodies whichbpriducw large amounts of heat energy and light energy as a result of the nuclear reactions occurring within them.

Stars have different colors and different sizes.

Red stars are the coldest stars and also the least massive.

From the chart, Star A which is a dwarf star has the coldest temperature, and therefore is a red star.

Learn more about red stars at: https://brainly.com/question/11562269

#SPJ2

Why most foods needs to be digested? Give at least 3 reasons

Answers

Answer:

Why most foods needs to be digested? Give at least 3 reasons.

Explanation:

Foods must be digested cause of the following reasons:

1. To get energy the food must be digested.

2. To provide nourishing vitamins and minerals to our body.

3. You will be affected by some diseases if you didn't digest your food.

16. In which of the following situations are the phenotypes of F2 offspring expected to follow
the ratio of 9:3:3:1?
a. monohybrid cross for two unlinked traits
b. a monohybrid cross for two closely linked traits
c. a dihybrid cross for two unlinked traits
d. a dihybrid cross for two closely linked traits​

Answers

Answer:

C

Explanation:

The F2 offspring of a cross would follow the ratio of 9:3:3:1 only if the cross is a dihybrid for two unlinked traits.

There is nothing like a monohybrid cross for two traits. A cross involving two traits is a dihybrid cross. Hence, options a and b are out of the equation.

A dihybrid cross for two closely linked traits would produce F2 offspring in another ratio that is different from 9:3:3:1 depending on the linkage map.

Hence, the correct option is C.

rko vs claymore who will win​

Answers

Answer:

claymore duh

Explanation:

Answer:

claymore

Explanation:

What determines which bases will be brought to the DNA strand during DNA replication?

Answers

Answer:
Replication relies on complementary base pairing, that is the principle explained by Chargaff's rules: adenine (A) always bonds with thymine (T) and cytosine (C) always bonds with guanine (G).

What is the difference between a molecule and a diagram of a molecule ?

Answers

Answer: The molecule itself is the actual thing present.

while the diagram explains what makes up a molecule or what it looks like structurally

Explanation:

multiple choice
Daytime temperatures on Mercury are extremely hot because:

1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes

Answers

Answer: it has long days

Explanation:

Other Questions
Please help!! Find the length of the radius of circle O. 53. The plan of a building is in the form of a rectangle withcenterline dimension of outer walls as 9.7mx14.7m. Thethickness of the wall in super structure is 0.30m. Then itsplinth area isa) 150mb) 145m2c) 145.5md) 135.36m. I DONT GET NUMBER 4, SOMEONE SMART DO IT FOR ME. IM GIVING BRINLIEST!! History, Help I really need this giving brainliest to the person with the correct answer, please explain your answer.. Help picture above thank you An integer can be positive, negative, or _____. opposite zero equivalent 2.1.PS-14Error Analysis A contractor purchases 7 dozen pairs of padded work gloves for $97.44. Heincorrectly calculates the unit price as $13.92 per pair for the expense report. What is the correctunit price? What is the error?The correct unit price is $per pair the receptionist said to the manager,'I have booked your flight tickects for Monday'. change into indirect speech plz help me asap i need this Hi! Hope You're Having A More Than Amazing Day!Please Help!For Jimena to be accepted into her favorite college, she will have to earn an entrance exam score at least 2 standard deviations above the mean. Assume entrance exam scores are normally distributed, with a mean of 790 and a standard deviation of 50. What exam score does Jimena need to be accepted at her favorite college? 690 890 740 840 The stem of a plant is experiencing phototropism. Which statement correctly describes the plant's response? After taking control of their government during the Great Depression, Japans military leadersclosed the country off from the rest of the world. planned a campaign of aggressive expansion.negotiated trade agreements with nearby countries.implemented democratic reforms, such as elections. Which of these are characteristics of all three main groups of worms? Check all that apply. They lack nerve cells.They can reproduce sexually.They display bilateral symmetry.They have a single tissue layer.They are invertebrates. Multiple choice April wants to multiply 6 and 42 using the distributive property. Which of the following number sentences shows howshe could do it?06x42 = 42 x606x(40+2) =(6x 40) + 2O(6x42) x1=6x (42 1)06x(40 +2) = (6x 4o) + (62) Solve for the missing variable plzz If at some point in time an object has zero velocity and zero acceleration, what does that mean about its motion at the next instant If the point (4,-2) Is Included in dunOA. (4,2)OB. (-4,-2)OC. 12,-4)OD. (-2,4) what is the verb of private? Estoy escribiendo una novela de fantasa y juvenil, pero ahora nos como seguir con la historia. Consejos?I'm writing a fantasy and youth novel, but now I don't know how to go on with the story. Tips? The bowling alley charges a set fee for shoe rental and charges per game bowled. The totalcost of bowling can be modeled by c(b) = 5.75b + 4.25 Which statements about the functionare true?I.The cost for each game of bowling is $5.75.II.The shoes cost $5.75 to rent.III.The number of games bowled is represented by b.1.I and II only2.I and III only3.II and III only4.I, II and IIISubmit Answer