AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Answers

Answer 1

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g


Related Questions

5. Jackson shares what he calls "his little depressing story" about coral reefs in Jamaica following a hurricane. He claims destruction such as that in Jamaica is only getting worse. Please elaborate on why it is getting worse, being sure to tie in natural weather catastrophes to your answer.

Answers

Answer:

In Jacksons talk about his depressing story he talks about how after a natural disaster such as a hurricane there is some kind of successional sequence of recovery but now what's happening is that overfishing, pollution, and climate change are all interacting In a way that prevents the recovery.  

Explanation:

I had the same question in my marine science class and got it right.


What is a plant produced from a cross between two plants with different genetic constituents called

Answers

Answer:

What is a plant produced from a cross between two plants with different genetic constituents called hybrid plant.

Hybrid is a plant produced from a cross between two plants with different genetic constituents.

WHAT IS A HYBRID?

A hybrid is an individual organism produced from a cross between two parent organisms with different genetic constituent.

For example, a mule is a hybrid formed from a cross between a horse and a donkey.

Therefore, a plant produced from a cross between two plants with different genetic constituents is called hybrid.

Learn more about hybrid at: https://brainly.com/question/13978941

If a cell has 8 chromosomes, how many chromosomes will each of its daughter cells have after mitosis?

Answers

Answer:

From what I remember in my 9th grade biology class, it's usually half that amount.

A rainforest is an example of a

Answers

Answer:

tropical moist broadleaf forest

Answer:

It could be a rainforest biome, forest, or habitat

Explanation:

A little explanation or expanding could help for a more specific answer. Thank and rate plz.

what is the difference between plant cell nd animal cell​

Answers

Plant cells have walls and chloroplasts while animal cells do not

A plant cell contains a cell wall and chloroplasts, while animals cells do not have these cellular structures.

Chloroplasts are organelles required to produce energy in the form of ATP and thus synthesize simple carbohydrates (e.g., glucose) by the process of photosynthesis.

Cell walls are cellular structures that help to support and shape plant cells.

Moreover, plant cells generally contain big vacuoles, whereas animal cells generally exhibit small vacuoles.

In conclusion, a plant cell contains a cell wall and chloroplasts, while animals cells do not have these cellular structures.

Learn more about plant cells and animal cells here:

https://brainly.com/question/560579

Why does a plant cell have a fixed shape and an animal cell does not?
The cell membrane of a plant cell is surrounded by a cell wall.
O Plant cells have larger vacuoles than animal cells.
O The process of photosynthesis causes plant cells to have a rigid shape.

Answers

Answer:

it is because a plant cell is surrounded by a cell wall

What type of mutation changes a single DNA nucleotide base, and causes a change in a specific codon?

Answers

Answer:

A base substitution mutation is the answer.

Explanation:

A base substitution mutation changes only a single nucleotide within a gene sequence, so only one codon is affected.

the role of dna in cellular differentaation

Answers

Answer:

controls the way cells function, also determines what type of specialized cells will be made.

Consider the fact that cancer is most easily defeated when it is found early, and then consider the time and expense involved in diagnosing a potential case of cancer.

Answers

Answer:

Early diagnosis of cancer focuses on detecting symptomatic patients as early as possible so they have the best chance for successful treatment. When cancer care is delayed or inaccessible there is a lower chance of survival, greater problems associated with treatment and higher costs of care.

Explanation:

how does cytokinesis happen in prokaryotes

Answers

Like...Rate...my answers

Follow me for

Like eukaryotes, cytokinesis is the last stage of separation for prokaryotes in a process called binary fission. ... During binary fission, a prokaryote begins by replicating its nucleiod (DNA) in the cell. Once this happens, the two nucleiods travel to the ends of the cell where there is cytokinesis

Like eukaryotes, cytokinesis is the last stage of separation for prokaryotes in a process called binary fission. ... During binary fission, a prokaryote begins by replicating its nucleiod (DNA) in the cell. Once this happens, the two nucleiods travel to the ends of the cell where there is cytokinesis.

is there vaccine for cancer​

Answers

Answer:

yes

there is vaccines for cancer

Explanation:

plz mark me as brilliant please please please

Labor unions arose in the nineteenth century as increasing numbers of Americans took jobs in factories, mines, and mills in the growing industrial economy.

The Knights of Labor, founded in 1869, was the first major labor organization in the United States. The Knights organized unskilled and skilled workers, campaigned for an eight hour workday, and aspired to form a cooperative society in which laborers owned the industries in which they worked.

The Knights’ membership collapsed following the 1886 Haymarket Square riot in Chicago. By 1886 the American Federation of Labor (AFL), an alliance of skilled workers’ trade unions, was growing.

When plants undergo photosynthesis a reaction produces sugar oxygen and water during respiration stored energy from the products of photosynthesis is converted to usable energy and what form is the energy stored prior to use in respiration

Answers

The answer is: chemical energy

Which of the following structures are found in both plant and animal cells?
O Mitochondria
O Chloroplast
O Cell Wall

Answers

The cellular structures found in both plant cells and animal cells are mitochondria.

Mitochondria are organelles and represent the energy factories of eukaryotic cells because they generate energy by the process of cellular respiration.

Cellular respiration refers to the metabolic processes used by both plant and animal cells in order to generate ATP by using the energy stored in the chemical bonds of foods and oxygen.

Cellular respiration has three main stages: glycolysis, the Krebs cycle and oxidative phosphorylation.

The Krebs cycle and oxidative phosphorylation occur in the mitochondria, whereas glycolysis occurs in the cytoplasm.

In conclusion, the cellular structures found in both plant cells and animal cells are mitochondria.

Learn more about mitochondria here:

https://brainly.com/question/10688306

Which type of effort to preserve species do you
think is most worthwhile?

Answers

One of the most effective and worthwhile methods of species preservation is the preservation and protection of wildlife habitats.

What is a habitat?In the most simple of terms, a habitat is a section of terrain in which certain organisms live. Habitats can range from deserts to rainforests and everything in between.

How protecting them can be important.The protection of habitats is of utmost importance. The leading cause of species extinction is habitat loss due to human activities such as city expansions or the collection of raw materials for industrial use. Protecting species habitats will allow the species in question to not only survive but also thrive and reproduce, thus leading to a safe population number and avoiding extinction.

Therefore, we can confirm that one of the most effective and worthwhile methods of species preservation is the preservation and protection of wildlife habitats to allow the species that live in them to thrive.

To learn more about Habitats visit:

https://brainly.com/question/7038386?referrer=searchResults

Identify the 4 factors that cells vary by.​

Answers

Answer:

Different types of cells have different shape-shifting capabilities, depending on the specific function of that cell in the organism. Three general factors determine cell shape: the state of the cytoskeleton, the amount of water that is pumped into a cell, and the state of the cell wall.

Explanation:

If any questions, put them below.

If you have no questions, please have a great rest of your day/night!

Which is an example of a statement about climate?

OPTIONS

It rained 3 inches last night.



Snow and very low temperatures are predicted for tomorrow.



Florida is known for its sunny skies and warm temperatures.



I plan to go swimming tomorrow.

Answers

Answer: Florida is known for its sunny skies and warm temperatures.

Explanation: Climate refers to long term weather. This statement indicates that Florida has a usual weather. Usual can be otherwise known as long-term.

The proccess of photosynthesis can be represented by the chemical formula _________

Answers

Answer:

6H2O + 6CO2 ----- C6H1206 + 6O2

A birdwatcher wants to identify an eastern bluebird. What feature of a bird should the birdwatcher evaluate first to identify an eastern bluebird?

Answers

Explanation:

In this case, I would suggest looking at the overall color of the bird as well as notable color patches on the wings, tail, or the head.

Also note whether or not the edges where colors meet are blurred or smooth/blended.

scientific question about a monkey

Answers

Did we get our way of think through monkeys or spontaneously?
This ones weird but did man come from monkey?

Which RNA types are involved in translation?

A. mRNA, tRNA, siRNA
B. siRNA, tRNA, rRNA
C.tRNA, rRNA, mRNA
D. rRNA, siRNA, tRNA

Answers

C. Is the answer for sure

what is the effect of atmospheric disturbances on stars

Answers

This the correct answer

Explanation:

However,when light enters the Earth's atmosphere,the different wind speeds distort the light waves,leading to distortions in the image of stars.The effects of the atmosphere can be modeled as rotating cells of air moving trubulently.

#carryonlearning

#brainlyeveryday

#ctto

Cells spend most of their time in what phase?

Answers

Answer:

A cell spends most of its time in what is called interphase

Explanation:

An animal is grouped as an insect if it has:


eight legs

six legs

Or a backbone

Answers

Answer: six legs :)

write any two adaptational characteristics of the plants found in mountain region​

Answers

Answer:

Branches are sloping.

Trees have a cone shape.

The leaves have a needle shape.

The accumulation of snow is prevented by special structures.

Thick bark on trees.Explanation:

What properties do all liquids share

Answers

They have definite volumes, but no shape, they can change shapes based on the shape of the container.

Briefly explain how DNA profiling is used to identify individuals.

Answers

A sample of DNA is taken from blood of saliva. PCR makes lots of copies, or amplifies the DNA. We then add restriction enzymes to cut the DNA at palindrome sequences. We then run the DNA through gel Elecrophoresis. Each person has unique short tandem repeats that cause a unique number of cuts by the restriction enzyme. These cuts are separated by size on gel electrophoresis, so no two people have the exact same pattern. We can compare individuals banding patterns to what is found at a crime scene, taken in previous samples, in a baby, and the sample that matches all the banding patterns will be the individual.

All living things have internal that helps them carry out basic functions.​

Answers

true

................................

Answer:

True

Explanation:

By the end of grade 2. All organisms have external parts. Different animals use their body parts in different ways to see, hear, grasp objects, protect themselves, move from place to place, and seek, find, and take in food, water and air. Plants also have different parts (roots, stems, leaves, flowers, fruits) that help them survive, grow, and produce more plants.  

By the end of grade 5. Plants and animals have both internal and external structures that serve various functions in growth, survival, behavior, and reproduction. (Boundary: Stress at this grade level is on understanding the macroscale systems and their function, not microscopic processes.)  

By the end of grade 8. All living things are made up of cells, which is the smallest unit that can be said to be alive. An organism may consist of one single cell (unicellular) or many different numbers and types of cells (multicellular). Unicellular organisms (microorganisms), like multicellular organisms, need food, water, a way to dispose of waste, and an environment in which they can live.  

Within cells, special structures are responsible for particular functions, and the cell membrane forms the boundary that controls what enters and leaves the cell. In multicellular organisms, the body is a system of multiple interacting subsystems. These subsystems are groups of cells that work together to form tissues or organs that are specialized for particular body functions. (Boundary: At this grade level, only a few major cell structures should be introduced.)  

By the end of grade 12. Systems of specialized cells within organisms help them perform the essential functions of life, which involve chemical reactions that take place between different types of molecules, such as water, proteins, carbohydrates, lipids, and nucleic acids. All cells contain genetic information in the form of DNA molecules. Genes are regions in the DNA that contain the instructions that code for the formation of proteins, which carry out most of the work of cells.  

Multicellular organisms have a hierarchical structural organization, in which any one system is made up of numerous parts and is itself a component of the next level. Feedback mechanisms maintain a living system’s internal conditions within certain limits and mediate behaviors, allowing it to remain alive and functional even as external conditions change within some range. Outside that range (e.g., at a too high or too low external temperature, with too little food or water available), the organism cannot survive. Feedback mechanisms can encourage (through positive feedback) or discourage (negative feedback) what is going on inside the living system.

A central feature of life is that organisms grow, reproduce, and die. They have characteristic structures (anatomy and morphology), functions (molecular-scale processes to organism-level physiology), and behaviors (neurobiology and, for some animal species, psychology). Organisms and their parts are made of cells, which are the structural units of life and which themselves have molecular substructures that support their functioning. Organisms range in composition from a single cell (unicellular microorganisms) to multi-cellular organisms, in which different groups of large numbers of cells work together to form systems of tissues and organs (e.g., circulatory, respiratory, nervous, musculoskeletal), that are specialized for particular functions.  

Special structures within cells are also responsible for specific cellular functions. The essential functions of a cell involve chemical reactions between many types of molecules, including water, proteins, carbohydrates, lipids, and nucleic acids. All cells contain genetic information, in the form of DNA. Genes are specific regions within the extremely large DNA molecules that form the chromosomes. Genes contain the instructions that code for the formation of molecules called proteins, which carry out most of the work of cells to perform the essential functions of life. That is, proteins provide structural components, serve as signaling devices, regulate cell activities, and determine the performance of cells through their enzymatic actions.

The following table provides phenotypic data for a population of mammoths living in cold environments based on fossil and DNA evidence.

Characteristic Percent of Population Showing Trait by Generation
Generation 1 Generation 2 Generation 3
Tusks greater than 2.5 m in length 25 25 25
Tusks less than 2.5 m in length 75 75 75
Mass greater than 4,000 kg 15 15 15
Mass less than 4,000 kg 85 85 85
Fur thickness greater than 6 cm 15 25 35
Fur thickness less than 6 cm 85 75 65
Based on this data and your knowledge of natural selection, which explanation best explains the trends seen in the data?

A. Individuals with thicker fur had a survival advantage in the cold environment, allowing these individuals to reproduce more often and create more offspring.
B.Individuals within this population of mammoths tend to only mate with individuals that have thick fur.
C.This population of mammoths appear to be in Hardy-Weinberg equilibrium since no allele frequencies are changing over time.
D.Individuals with thick fur migrated into the population of mammoths, increasing the proportion of these individuals.

PLEASEEE HELPPP MEEEE!!!!

Answers

Answer:

Individuals with thicker fur had a survival advantage in the cold

Explanation:

Natural selection means the process of changing the adapting the new environment. Based on the given data one can conclude that the individual with thicker fur had a survival advantage in the cold environment.

Why natural selection occurs?

Natural selection takes place due to 3 underlying reasons:

ReproductionHeredityVariation in fitness of organisms.

Due to these reasons, natural selection can leads to speciation.

As the individual are living in cold environment, they need to adapt the change in environment. So, individuals with thicker fur had a survival advantage in the cold environment, allowing these individuals to reproduce more often and create more offsprings.

Thus, option A is correct.

For more details about natural selection, visit:

https://brainly.com/question/9830102

Mrs. Jones who has dementia. She continues to ask for her husband, whom you know passed away several years ago. How would you assist Mrs. Jones?"

Answers

Answer:

You tell her that her husband is away and will be coming back later

Explanation:

If you tell her he's dead, she won't believe you so just go along with it.

In 2018, the average age for first marriage in the United States was 29.8 years for men and 27.8 years for women. These ages for first
marriages are

Answers

Those ages for first marriages are averages

These ages for first marriages are Average age .

What is the average age of first marriage in the United States?

The median age at first marriage for women was 28 years in 2015-2019, up from 26.3 in 2006-2010. The median age at first marriage for men was 29.9 years in 2015-2019, up from 28.1 in 2006-2010.

What is the median age at first marriage for women?

In 2019, the median age for the first wedding among women stood at 28.4 years.

To learn more about Median ages for marriage , here

https://brainly.com/question/11878704?referrer=searchResults

#SPJ2

Other Questions
plssssssssssssssssss Traditional direct marketing tools include ________.A. websites, catalog marketing, telemarketing, e-mail, kiosks, and online videosB. catalog marketing, telemarketing, websites, e-mail, direct mail marketing, and online advertisingC. catalog marketing, telemarketing, websites, e-mail, online videos, and blogsD. face-to-face selling, direct-mail marketing, catalog marketing, telemarketing, direct-response televisionmarketing, and kiosk marketingE. catalog marketing, online advertising, e-mail, telemarketing, direct-response television marketing, and websites Write an equation of a line that is perpendicular to y = 2/3 x + 8 and has a y-intercept of2.Answer in slope-intercept form What is the value of x + y for the system of equations y= 2x - 2 and y= 4x + 6? A decision-maker faces the following decision under conditions of uncertainty. This decision-maker has $1 million in assets. Most of those assets, $750,000, are the individuals equity in his house. The remaining $250,000 are absolutely secure. Unhappily, there is a risk that the individuals house will burn down in a fire, which would be a total loss of the $750,000. The individual can insure his house against the loss from this fire. The premium for the insurance is $40,000, and it will insure the individual completely; that is, if the individual chooses to purchase this insurance policy, his assets will be $960,000, whether or not there is a fire. (There is no mortgage on the house, so $750,000 is the full amount paid by the insurance company.) The probability of a fire is 0.05. Required:a. What is the expected net earnings, the premium less the expected amount paid out to the client, to the insurance company from this policy? b. If the individual in question were risk neutral, would he buy this insurance policy? c. If the individual in question is an expected utility maximizer, with the utility function u(a) = where a is the individuala's total assets, would this individual buy the insurance? The triangles are congruent due to which criteria?SAASASSSSHL Find the equation that represents the proportional relationship in this graph, for y in terms of x. What risks could there be in having the vast majority of a countrys agricultural production dependent on one crop? Tim is 40 lbs less than his bother. If together they weigh 220, how much does Tim weigh? 25. Which is a solution of the inequality y (3,-5)(2,-1)(4,1)(6,-4) Help help hep pelsss straightforward answer ASAP Ill give points I need to pass class Please help? I need this done by tonight. how to find the perimeter of a triangle with vertices 2/7x9 in simplest form how to sovle (x+1/x)^2 how is it possible that plants can express firefly genes? The area of a square pond is 1000m2.A path of uniform width is surrounded outside the pond and its area is 369m2.find the outer length of the path a farm is sold for $457000, which gives a profit of 19%. Find the profit 3/4c-7/12+7/24c+2/3-1/6csimplify the expression I NEED HELP!!!!!Please write two or three paragraphs about your opinion aboutDo celebrity get off easier when they break the law?