A student spends 17/35 of his pocket money on transport. He spends 5/6 of the remainder on sweet, what fraction of his pocket money did he spend on sweet?​

Answers

Answer 1

Answer:

Step-by-step explanation:

Let he have Rs . 1

spent on transport  =  17/35

                               

spent on sweet  =  5/6 of  18/35

                   =  3/7


Related Questions

100

If hypotenuse of an isosceles right-angled triangle is 3(root)2cm, then each of other side is of

Answers

If the hypotenuse of an isosceles right-angled triangle is 3√2 cm, then each of the side of the triangle is 3 cm.

Given that,

Hypotenuse of the right angled triangle = 3√2 cm

Since the triangle is isosceles, the other two sides or the legs of the triangle will have equal length.

Let x be the length of each leg.

Using Pythagoras theorem,

x² + x² = (3√2)²

2x² = 18

x² = 9

x = 3

Hence the length of each side is 3 cm.

Learn more about Right Triangles here :

https://brainly.com/question/29889951

#SPJ1

Brian says the graph shows the circle with a center (-3, 2) and a radius of 2. Mia says the graph shows all possible centers for a circle that passes through (-3, -2) with a radius of 2. Which student is correct? Explain.

Answers

Brian is correct, because the graph shows the circle with a center (-3, 2) and a radius of 2.

Since, The circle is a closed two dimensional figure , in which the set of all points is equidistance from the center.

We have to given that;

Brian says the graph shows the circle with a center (-3, 2) and a radius of 2.

And, Mia says the graph shows all possible centers for a circle that passes through (-3, -2) with a radius of 2.

Now, By given graph we can see that,

Center of circle = (- 3, 2)

And, Radius of circle = - 1 + 3 = 2

Hence, Brian is correct, because the graph shows the circle with a center (-3, 2) and a radius of 2.

Learn more about the circle visit:

https://brainly.com/question/24810873

#SPJ1

Drag each number to a box to complete the table. Each number may be used once or not at all. 8,000533,00021,000 Kilometers Meters 1 2,000 5,000 8

Answers

Each number should be dragged to a box to complete the table as follows;

Kilometers     Meters

1                        1,000

2                       2,000

3                       3,000

5                       5,000

8                       8,000

What is a conversion factor?

In Science and Mathematics, a conversion factor can be defined as a number that is used to convert a number in one set of units to another, either by dividing or multiplying.

Generally speaking, there are one (1) kilometer in one thousand (1,000) meters. This ultimately implies that, a proportion or ratio for the conversion of kilometer to meters would be written as follows;

Conversion:

1 kilometer = 1,000 meters

2 kilometer = 2,000 meters

3 kilometer = 3,000 meters

4 kilometer = 4,000 meters

5 kilometer = 5,000 meters

6 kilometer = 6,000 meters

7 kilometer = 7,000 meters

8 kilometer = 8,000 meters

Read more on conversion factor here: brainly.com/question/28308386

#SPJ1

Missing information:

The question is incomplete and the complete question is shown in the attached picture.

30 pts!!
Need help asap

Answers

The equation of the graph is (b) y = (x + 4)(x + 2)(x - 1)

How to identify the equation of the graph

From the question, we have the following parameters that can be used in our computation:

The graph

The graph is a polynomial graph with the following zeros and multiplicities

Zeros of -4, -2 and 1 with multiplicities of 1y-intercept at y = -8

The equation is then represented as

y = (x - zero) to the exponent of the multiplicities

So, we have

y = (x + 4)(x + 2)(x - 1)

Hence, the equation of the graph is (b) y = (x + 4)(x + 2)(x - 1)

Read more about polynomial at

https://brainly.com/question/7693326

#SPJ1

y = log₂ X
Compression of ½, down 5 and left 7

Write the equation with the given parent and the given transformation.

Answers

Answer:

y = (1/2)log₂ (x - 7) - 5

Which two functions can be used to solve for x?

Answers

The expression that should be used is tan 67° = 210/x, tan 23° = x/210.

Given is a figure, we need to find the value of x,

So, the figure is creating a right triangle, the angle of elevation is equal to the angle of depression,

So, the two acute angles in the triangle will be 23° and 67°.

Also, the tangent of an angle is equal to the ratio of the perpendicular side to the base,

Taking 67° as reference angle, we get,

Tan 67° = x / 210

Taking 23° as reference angle, we get,

Tan 23° = 210/x

Hence the expression that should be used is tan 67° = 210/x, tan 23° = x/210.

Learn more about tangent of an angle click;

https://brainly.com/question/18940349

#SPJ1

35 POINTS!!!

What is the measurement angle of angle C and D in the image

Answers

Answer:

c = 45 and e = 30

Step-by-step explanation:

Since we know that A = 45, B = 90, we can calculate C knowing that the total angle of a triangle is 180, so you do 180-45-90 = 45

Finding the angle C helps us find F by subtracting 45 from 180, since a straight line is 180 degrees, which is 135.

We know that E = 15, and what was said earlier about how the toal angle is 180 in a triangle, we can subtract 15 and 135 from 180, which is 30.

Hope that answers your question

What the meaning of statement this?

Answers

Axiom of Infinity states that there is at least one set that contains an infinite number of elements.

A basic tenet of set theory, the Axiom of Infinity affirms the existence of an endless set. In plainer language, it proves that at least one set has elements with an infinite number.

This axiom is crucial because it enables rigorous and consistent mathematical reasoning about and interaction with infinite collections. It offers a fundamental premise for many infinity-related mathematical notions and structures, including infinite sequences, series, and cardinality.

The Axiom of Infinity ensures that mathematics is not restricted to only finite quantities and allows for the exploration of the rich and intriguing realm of infinite structures by declaring the existence of an endless set.

Learn more about axiom here:

https://brainly.com/question/31203196

#SPJ1

A boat's value over time is given as the function f(x) and graphed below. Use A(x) = 400(b) +0 as the parent function. Which graph shows the boat's value increasing at a rate of 25% per year? (2 points)

Answers

Graph is attach below for this question and the equation of this graph is

A(x) = 400(1.25)ˣ +0

We have,

In mathematics, "graph" can refer to (at least) two different things. In elementary mathematics, the term "graph" indicates a plot or a function graph. A graph is, in the language of mathematicians, a set of points and the connections between some subset of those points (which may be empty).

Given that the boat's value increasing at a rate of 25% per year.

So after each year the value becomes = 1 + 25% = 1 + 0.25 = 1.25 of the previous year.

So the equation becomes: A(x) = 400(1.25)ˣ +0

Since, b = 1.25 > 1, so A(x) is a increasing function. And for every value of x, A(x) < 0.

To Learn more about function , visit:

brainly.com/question/29631554

#SPJ1

The points S(-4,-2), T(-4, 5), and
U(-9, -2) form a triangle. Plot the points
then click the "Graph Triangle" button. Then find the perimeter of the triangle.
Round your answer to the nearest tenth if necessary.

Answers

The perimeter of the triangle  STU is 20.6 units

What is the perimeter of the triangle?

To find the perimeter of triangle STU, we need to use the formula of distance between two points and then take the sum of all the sides.

[tex]d = \sqrt{(x_2 - x_1)^2 + (y_2 - y_1)^2}\\[/tex]

For line ST;

(-4, -2) and (-4, 5)

[tex]d = \sqrt{(-4 - (-4))^2 + (5 - (-2))^2} \\d = 7[/tex]

For line TU;

(-4, 5) and (-9, -2)

[tex]d = \sqrt{(-9 - (-4))^2 - (-2 - 5)^2} \\d = \sqrt{74} \\d = 8.6[/tex]

For line US;

(-9, -2) and (-4, -2)

[tex]d = \sqrt{(-9 - (-4))^2 + (-2 - (-2))^2}\\d = 5[/tex]

The distance between the sides are 7, 8.6 and 5 units.

The perimeter of the triangle = 7 + 8.6 + 5 = 20.6 units

learn more on perimeter of triangle here;

https://brainly.com/question/17394545

#SPJ1

The radius of a circle is 15 kilometers. What is the angle measure of an arc 7​ kilometers long?

Answers

Answer:

26.74 degrees!

Step-by-step explanation:

The formula you can plug the numbers into is:

angle = L / r

Angle = the central angle

L = the length of the arc

r = radius of the circle

The PTA is holding a raffle. The prize is a camera worth $200. Each raffle ticket costs $5. One hundred tickets are sold and a winner is drawn at random. Find the expected value of the purchase of a ticket.

Answers

The expected value of the purchase of a ticket is -$2.95.

To find the expected value of the purchase of a ticket, we need to consider the probability of winning and the amount of money gained or lost.

Given:

The cost of a raffle ticket is $5.

The prize is a camera worth $200.

One hundred tickets are sold.

To calculate the expected value, we multiply the probability of winning by the value gained and subtract the probability of not winning by the cost of the ticket.

Probability of winning:

Since there are 100 tickets sold and only one winner, the probability of winning is 1/100, or 0.01.

Value gained:

If the ticket is a winning ticket, the value gained is $200.

Probability of not winning:

The probability of not winning is 99/100, or 0.99, as there is only one winner out of 100 tickets.

Cost of the ticket:

The cost of a ticket is $5.

Now, let's calculate the expected value:

Expected value = (Probability of winning × Value gained) - (Probability of not winning × Cost of ticket)

= (0.01 × $200) - (0.99 × $5)

= $2 - $4.95

= -$2.95

The expected value of the purchase of a ticket is -$2.95.

This means that, on average, for each raffle ticket purchased, a person can expect to lose approximately $2.95.

for such more question on expected value

https://brainly.com/question/15858152

#SPJ8

Lend a hand with this please. A coin is tossed and a die is rolled What is the probability that the coin shows heads and the die shows an odd number?

Answers

1/4 or 0.25 is the probability that the coin shows heads and the die shows an odd number.

To find the probability that the coin shows heads and the die shows an odd number, we need to consider the possible outcomes for each event and calculate the probability of their intersection.

For the coin toss, there are two possible outcomes: heads (H) or tails (T). Each outcome has an equal chance of occurring, so the probability of the coin showing heads is 1/2.

For the die roll, there are six possible outcomes: 1, 2, 3, 4, 5, or 6. Out of these outcomes, three numbers (1, 3, and 5) are odd. Again, each outcome has an equal chance of occurring, so the probability of rolling an odd number is 3/6 or 1/2.

To find the probability of both events occurring, we multiply the individual probabilities:

Probability of coin showing heads = 1/2

Probability of die showing an odd number = 1/2

Probability of both events occurring = (1/2) * (1/2) = 1/4

Therefore, the probability that the coin shows heads and the die shows an odd number is 1/4 or 0.25.

This means that out of all possible outcomes from tossing a coin and rolling a die, there is a 1 in 4 chance that the coin shows heads and the die shows an odd number. It's important to note that this calculation assumes fair and unbiased coin and die, where the probabilities of each outcome are equally likely.

Know more about Probability here:

https://brainly.com/question/13604758

#SPJ8

A company invests $760,000 a year for 8 years at 5.2% annual rate. How much interest will they earn?

Answers

Answer:

$316,160.00

Step-by-step explanation:

Interest is the amount of money earned on an initial investment.

Simple Interest

Since the question does not talk about being compounded, we can assume the company is earning simple interest. Simple interest is the amount of money earned on the principal. The principal is the initial investment. Additionally, interest is earned at a specific rate; in this case, the rate is 5.2% each year.

Interest Formula

The formula to find the amount of interest earned is I = Prt. In this formula, I is the amount of interest earned, P is the principal, r is the rate as a decimal, and t is the time in years. To find the interest earned, all we need to do is plug in the information we know.

I = 760,000 * 8 * 0.052I = $316,160

The account will earn $316,160 of interest.

We can also determine the total of the account by using the formula A = P (1 + rt). If we solve this formula, we can figure out that the account total is $1,076,160.

Which equation represents a quadratic function with a leading coefficient of 2 and a constant term of -3?
A - f(x)=2x^3-3
B - f(x)=3x^2-3x+2
C - f(x)=-3x^3+2
D - f(x)=2x^2+3x-3

Answers

Answer:

B - f(x)=3x^2-3x+2

Step-by-step explanation:

Answer:

D

Step-by-step explanation:

Degree of the quadratic function is 2.The leading co-efficient is the co-efficient of the term with highest degree (that is 2).

f(x) = 2x² + 3x - 3

This function satisfies the given condition.

The leading term is 2x² and its co-efficient is 2 and the constant term is (-3)

Given AC is congruent to BD and angle CAB is congruent to angle DBA.

Prove triangle ABC is congruent to triangle BAD

Answers

By the Side-Angle-Side (SAS) congruence criterion, triangle ABC is congruent to triangle BAD.

To prove that triangle ABC is congruent to triangle BAD based on the given information, we can apply the Side-Angle-Side (SAS) congruence criterion.

AC is congruent to BD (Side)

angle CAB is congruent to angle DBA (Angle)

To prove triangle ABC congruent to triangle BAD using the SAS congruence criterion, we need to show that they share two congruent sides and a congruent angle between them.  

Side AB is common to both triangles.

Side AC is congruent to BD (given).

angle CAB is congruent to angle DBA (given).

By satisfying the SAS congruence criterion, we can conclude that triangle ABC is congruent to triangle BAD.

The SAS congruence criterion states that if two sides and the included angle of one triangle are congruent to two sides and the included angle of another triangle, then the two triangles are congruent.

In this case, we have side AB in common, and side AC is congruent to BD, along with angle CAB being congruent to angle DBA.

Therefore, all the conditions of the SAS criterion are satisfied.

Hence, we can conclude that triangle ABC is congruent to triangle BAD based on the given information.

For similar question on congruence criterion.

https://brainly.com/question/30094441

#SPJ11

I need help with question 4

Answers

The output of the exponential function when x = 5 is given as follows:

f(5) = 96.

How to define an exponential function?

An exponential function has the definition presented as follows:

[tex]y = ab^x[/tex]

In which the parameters are given as follows:

a is the value of y when x = 0.b is the rate of change.

The parameter values for this problem are given as follows:

a = 3, as when x = 0, f(x) = 2.b = 2, as when x is increased by one, f(x) is multiplied by two.

Hence the function is given as follows:

[tex]f(x) = 3(2)^x[/tex]

The numeric value at x = 5 is given as follows:

[tex]f(5) = 3(5)^x = 96[/tex]

More can be learned about exponential functions at brainly.com/question/2456547

#SPJ1

Can someone help me on 3-6?

Directions: Find the volume of each figure. Round the nearest hundredth.

Answers

Using the formula of volume of a sphere and hemisphere, the volume of the figures are given as;

1. 2144.57 m³

2. 696.6 m³

3. 20569.1m³

4. 2637ft³

5. 56.5km³

6. 6381.79 in³

What is volume of sphere?

The volume of a sphere is given as 4/3πr³

Where π is a constant whose value is equal to 3.14 approximately. “r” is the radius of the hemisphere.

1. The volume of the sphere is;

v = 4/3 * 3.14 * 8³ = 2144.57m³

2. The volume of the sphere is;

v = 4/3 * 3.14 * (11/2)³ = 696.6m³

3. The volume of the sphere is;

v = 4/3 * 3.14 * 17³ = 20569.1m³

4. The volume of the hemisphere is;

v = 2/3 * 3.14 * 10.8³ = 2637ft³

5. The volume of the hemisphere is;

v = 2/3 * 3.14 * 3³ = 56.5km³

6. The volume of the hemisphere is;

v = 2/3 * 3.14 * (29/2)³ = 6381.79in³

Learn more on volume of sphere here;

https://brainly.com/question/22807400

#SPJ1

6:1 scale with dimensions of 24 inches by 36 inches. what are the real dimensions?

Answers

The real dimensions of the object are 144 inches by 216 inches.

Given that, 6:1 scale with dimensions of 24 inches by 36 inches.

The basic formula to find the scale factor of a figure is expressed as,

Scale factor = Dimensions of the new shape ÷ Dimensions of the original shape.

In a 6:1 scale, the real dimensions of an object would be 6 times the scaled dimensions. Therefore, the real dimensions of the object given in the question would be 24 inches x 6 = 144 inches by 36 inches x 6 = 216 inches. So, the real dimensions of the object are 144 inches by 216 inches.

Therefore, the real dimensions of the object are 144 inches by 216 inches.

To learn more about the scale factor visit:

https://brainly.com/question/22312172.

#SPJ1

Find the equation of the line.
Use exact numbers.

Answers

Answer:

Step-by-step explanation:

What are the sums? Complete the equations.
-80+30=
80+ (-30) =

Answers

-80+30=-50
80+(-30)=50

Which of the following steps would you perform to the system of equations
below so that the equations have opposite y-coefficients?
4x+2y=4
12x - y = 26

Answers

You would multiply the entire second equation by -2, which would make the y-coefficient change from -1 to 2 and become opposite to the y-coefficient of the first equation. The new equations would be:

4x + 2y = 4
-24x + 2y = -52

Which expression is equivalent to "9 more than the quotient of x and 5

Answers

The required expression is (x / 5) + 9

Given that we have to build an equation for the statement "9 more than the quotient of x and 5,

So,

This expression represents the quotient of x divided by 5, and then adding 9 to the result.

Therefore,

"9 more than the quotient of x and 5" can be written mathematically as:

(x / 5) + 9

Hence the required expression is (x / 5) + 9

Learn more about expression click;

https://brainly.com/question/15994491

#SPJ1

The top of a tree makes angles s and t with Points K and L on the ground, respectively, such that the angles are complementary. Point K is x meters and Point L is y meters from the base of the tree.



a. In terms of x and y, find the height of the tree. Include your work.
b. If s = 38° and y = 3 meters, calculate the height of the tree, rounded to two decimal places.

Answers

1. In terms of x and y, the height of the tree is  and

2. The height of the tree is 6.71 meters

Since, From the question, we are to determine the height of the tree in terms of x and y

Hence, By Using SOH CAH TOA, we can write that

tan t° = h / y

h = y × tan t°

Also, We get;

tan s° = h / x

h = x × tan s°

2. If m ∠t = 38° and y = 3 meters,

Then, the height of the tree;

h = 3 × tan 38°

h = 3 × 0.78 meters

h = 2.34 meters

Hence, the height of the tree is 2.34 meters.

Learn more on Trigonometry here:

brainly.com/question/15977788

#SPJ1

Sarah fenced in her backyard. The perimeter of the yard is 18 feet, and the width of the yard is 4 feet. Use the perimeter formula to find the length of the rectangular yard in inches: P = 2L + 2W. (1 foot = 12 inches)

96 in.
60 in.
10 in.
5 in.

Answers

Answer: 60 in.

Chain of Thought Reasoning:

Step 1: P = 2L + 2W

Step 2: 18 = 2L + 2(4)

Step 3: 18 = 8 + 2L

Step 4: 10 = 2L

Step 5: 5 = L

Step 6: Convert feet to inches: 1 foot = 12 inches

Step 7: 5 feet = 5 * 12 inches

Step 8: 5 feet = 60 inches

Therefore, the length of the rectangular yard is 60 inches.

A restaurant at the food court in a mall is offering a lunch special. The table shows the relationship between the number of side dishes and the total cost of the special.

Restaurant
Number of Side Dishes Total Cost
2 $10.25
4 $13.25
5 $14.75
8 $19.25


Which of the following graphs shows the relationship given in the table?

graph with the x axis labeled number of side dishes and the y axis labeled cost in dollars and a line going from the point 0 comma 7 and 25 hundredths through the point 3 comma 11 and 75 hundredths

graph with the x axis labeled number of side dishes and the y axis labeled cost in dollars and a line going from the point 0 comma 7 and 75 hundredths through the point 3 comma 12 and 25 hundredths

graph with the x axis labeled number of side dishes and the y axis labeled cost in dollars and a line going from the point 0 comma 5 and 25 hundredths through the point 3 comma 9 and 75 hundredths

graph with the x axis labeled number of side dishes and the y axis labeled cost in dollars and a line going from the point 0 comma 5 and 5 tenths through the point 5 comma 13

pls use pic for the answer

Answers

Graph with the x axis labeled number of side dishes and the y axis labeled cost in dollars and a line going from the point 0 comma 5 and 5 tenths through the point 5 comma 13

The x-axis of the graph is labeled "number of side dishes," which represents the independent variable in this case.

The y-axis is labeled "cost in dollars," representing the dependent variable.

The line on the graph starts at the point (2, $10.25), indicating that when there are 2 side dishes, the total cost of the lunch special is $10.25.

The line then passes through the point (8, $19.25), which signifies that when there are 8 side dishes, the total cost of the lunch special is $19.25.

This graph correctly illustrates the relationship between the number of side dishes and the total cost, showing that as the number of side dishes increases, the cost of the lunch special also increases.

To learn more on Graph click:

https://brainly.com/question/17267403

#SPJ1

In the triangle below, b =________. If necessary, round your answer to two
decimal places.
A
42°
C
Answer here
B
41.5%
37

Answers

Answer:

b ≈ 54.94

Step-by-step explanation:

using the Sine rule in Δ ABC

[tex]\frac{a}{sinA}[/tex] = [tex]\frac{b}{sinB}[/tex] = [tex]\frac{c}{sinC}[/tex]

where a is the side opposite ∠ A, b is opposite ∠ B , c is opposite ∠ C

we require to calculate ∠ B

∠ B = 180° - (42 + 41.5)° = 180° - 83.5° = 96.5°

to find b using the pair of ratios

[tex]\frac{b}{sinB}[/tex] = [tex]\frac{a}{sinA}[/tex] ( substitute values )

[tex]\frac{b}{sin96.5}[/tex] = [tex]\frac{37}{sin42}[/tex] ( cross- multiply )

b × sin42° = 37 × sin96.5° ( divide both sides by sin42° )

b = [tex]\frac{37sin96.5}{sin42}[/tex] ≈ 54.94 ( to 2 decimal places )

Find the value of x.
12, x, 17, 15, 10; The mean is 12.6.

Answers

Answer:x=9

Step-by-step explanation: 12.6x5 then subtract everything else.

Alg 2 unit 5-5 math questions with g and f

Answers

The composition fog is ((3,2), (1,0), (2,7)).

To find the composition fog, we need to apply function g first, and then apply function f to the result.

Let's start by applying function g:

g((-4,1)) = (-2,1)

g((0,4)) = (3,1)

g((1,0)) = (2,8)

Now, let's apply function f to the results:

f((-2,1)) = (3,2)

f((3,1)) = (1,0)

f((2,8)) = (2,7)

Therefore, the composition fog is:

fog = ((-4,1), (0,4), (1,0)) → g → f

= ((3,2), (1,0), (2,7))

So, fog = ((3,2), (1,0), (2,7)).

Learn more about Function here:

https://brainly.com/question/30721594

#SPJ1

The table shows three unique, discrete functions.
x f(x) g(x) h(x)
-1
0
3
185
15
2
3
0
-25
-10-204
2
3
2
-3
2
3
4
5
6
Which statements can be used to compare the
characteristics of the functions? Select three options.
Of(x) has the greatest maximum.
h(x) has the greatest x-intercept.
g(x) has the smallest minimum value.
All three functions share the same domain.
All three functions share the same y-intercept.

Answers

All thre functions share the same y intercept

We can analyze the characteristics of the given functions based on the information provided in the table.

We cannot determine which function has the greatest maximum based on the table alone, as we do not have the complete graph of any of the functions.

We can see from the table that h(x) has an x-intercept of 0, which is the smallest among the three functions. Therefore, we can say that h(x) has the smallest x-intercept.

We can see from the table that g(x) has a minimum value of -204, which is the smallest among the three functions. Therefore, we can say that g(x) has the smallest minimum value.

We cannot determine if all three functions share the same domain based on the table alone. We can only see that all three functions have been evaluated at the same set of input values.

We can see from the table that the y-intercept of f(x) is 2, the y-intercept of g(x) is 3, and the y-intercept of h(x) is 4. Therefore, we can say that all three functions have different y-intercepts.

Therefore, the statements that can be used to compare the characteristics of the functions are:

h(x) has the smallest x-intercept.

g(x) has the smallest minimum value.

All three functions have different y-intercepts.

Other Questions
Select the correct pronoun to complete this sentence.Neither Toni nor Erika completedO A. theirOB.herAmerican literature course. 10 Point Question 1 Jane figures that her monthly car insurance payment of $190 is equal to 30% of the amount of her monthly auto loan payment What is her total combined monthly expense for auto loan payment and insurance (rounded to the nearest dollar) Enter only the number without $sign S Blank 1 Blank 1 Add your answer 1 Why were reptiles better adapted than amphibians to life on land? Select all that apply. A. They had cutaneous respiration. B. They had thoracic breathing.C. They had watertight skinD.. The had amniotic eggs. Medicare is available to an individual who has worked at least:a. 5 years in Medicare-covered employment, is at least 65 years old, and is a permanent resident of the United Statesb. 10 years in Medicare-covered employment, is at least 62 years old, and is a citizen of the United Statesc. 10 years in Medicare-covered employment, is at least 65 years old, and is a citizen or permanent resident of the United Statesd. 25 years in Medicare-covered employment, is at least 62 years old, and is a citizen of the United States what problems contribute to the tense and volatile situation? consider byte-represented numbers, what are the 1's and 2's complement for the following binary numbers? 00010000? 1's: , 2's: 14 L- {(5+2)(5-5)} 8. (25 points) Use the convolution theorem to calculate L-1 a thread is always more efficient than a process for which two activities? a. thread creation b. sys5 ipc calls c. file open and file write calls d. thread termination At which root does the graph of f(x) = (x - 5)(x + 2)2 touch the x-axis?O-50-20205 Match each function with the name of a major enzyme class.1) transfer functional groups between molecules A) oxidoreductases2) catalyze intramolecular rearrangements B) transferases3) catalyze redox chemistry C) hydrolases4) catalyze the joining of two molecules together D) lyasesE) isomerasesF) ligases which market structure would likely have the highest concentration ratio? Use Pythagoras theorem calculate the length of the hypotenuse in this rightangled give your answer in centimetres and give any decimal answers to 1d. P TRANSLATE the mRNA sequence below into an amino acid sequenceusing your preferred codon chart. Type the ONE-LETTER CODES FORAMINO ACID SEQUENCE AS YOUR ANSWER. DO NOT use dashes oranything else to separate your letters.Type the amino acid sequence you get as your answer. *Use the 1-letter codes forthe amino acids* DO NOT PUT SPACES, DASHES, OR COMMAS BETWEEN THELETTERS!! NOTE: The amino acids should spell a WORD if done correctly.mRNA AACAUGAUGGCCAAAGAGUAAGCCA A cup of coffee is poured, and the temperature is measured to be 120 degrees Fahrenheit. The temperature of the coffee then decreases at a rate modeled by r(t)=55e0.03t2 degrees Fahrenheit per minute, where t is the number of minutes since the coffee was poured. What is the temperature of the coffee, in degrees Fahrenheit, at time t=1 minute? dy/dx + 2/x y = xy, y(1) = 1/2Find y(10) numerically using the following methods and h = 0.5, 0.25, 0.125 and calculate the errors in each case. You have to use MATLAB for this problem. a. Forward Euler's method b. Backward Euler's method C. Modified Euler's method d. Improved Euler's method e. Fourth-Order Runge Kutta Method philosophers, following plato, have traditionally defined knowledge as true justified belief. true/false? Imagine that you work for a large, global company that builds power plants for electricity. This industry has a long-term perspective and requires stable, reliable countries in order to make Foreign Direct Investments. You are assigned to evaluate the following countries for a long-term investment: South Africa, Nigeria, Algeria, or Kenya. Recall what you have learned in this chapter about political and legal factors and political ideologies, as well as earlier discussions about global business ethics and bribery. Provide and support your evaluation of each country and provide your recommendations to senior management. what intertidal zone do sea anemones typically inhabit? In a survey of 4013 adults, 722 say they have seen a ghostConstruct a 90% confidence interval for the proportion of people who say they have seen a ghost. Show your value for E , and your confidence interval . Find the most general antiderivative of the function. (Check your answer by differentiation. Use C for the constant of the antiderivative.) f()=9sin()5sec()tan() on the interval ( /2, /2 ) F()=