7. To what Super group does the ameba belong? ? mark as brainliest first to be correct​

Answers

Answer 1

Answer:

I-Hispanic okanye i-latino kunye ne-Hispanic okanye i-latino kunye ne-Hispanic okanye i-latino kunye ne-Hispanic okanye i-latino yendalo kwaye ayikho iplastiki endiyidlalayo ndiyenza bombastic

Answer 2
(Unikonta)
A number of protists plus animals and fungi comprises the supergroup unikonta. Many of the protists of the unikon are amebas. An amoeba is any organism or cell that, by stretching its plasma membrane, moves and feeds. The plasma membranes' extensions are known as 'pseudopods'.

Related Questions

What is the universe made of

Answers

Answer:

composition

Explanation:

the universe is composed almost completely of dark energy, dark matter , and ordinary matter

Answer: matter , atoms

Explanation:

How can you determine the number of bonds an atom can make

Answers

Answer:

The number of bonds for a neutral atom is equal to the number of electrons in the full valence shell (2 or 8 electrons) minus the number of valence electrons. This method works because each covalent bond that an atom forms adds another electron to an atoms valence shell without changing its charge.

Hello My name Is Chloe, Do you think you can help me with My Question
I need Facts on sharks.
I'm doing a report for school.
Thanks:)

Answers

Answers:

Here are some fact about sharks that i found cool

#1

Possibly one of the most evolved sharks today are hammerhead sharks. They have an advanced sensory system and a body shape that has adapted to hunt specific prey

#2

Sharks may be one of the most important species on Earth. They have been maintaining our oceans for over 400 millions years.

#3

Sharks have evolved and changed much over millions of years. However many sharks today still share some of the features as sharks from millions of years ago.

#4

Sharks have been in our oceans for over 400 million years. Some of the earliest sharks were discovered dating back to the Devonian age.

#5

Sharks have survived five massive planet extinction events. These extinction events killed most life on earth and the last one around 65 million yeas ago killed the dinosaurs.

#6

There are over 500 species of shark.

#7

It is believed that each whale shark's pattern is unique, like a human's fingerprint.

#8

Sharks do not have bones. Instead, they have cartilage, that's what makes up human noses and ears

#9

According to the Smit.hsonian, there are over 500 known shark species, though many are endangered or declining due to various factors like overfishing.

#10

Your odds of getting attacked and killed by a shark are 1 in 3,748,067. In a lifetime, you are more likely to die from fireworks or lightning. Whereas over 100 million sharks are killed every year by humans.

#11

Whale sharks are the world’s biggest fish.

#12

Sharks mature slowly and reach reproductive age anywhere from 12 to 15 years.

#13

Hammerhead sharks' eyes are on the sides of their heads, so they have nearly a 360-degree sight line. Their panoramic view of the undersea world is inhibited by two blind spots, one in front of the snout and the other directly behind the head.

#14

Sharks predate the dinosaurs by 200 million years.

#15

Great whites can detect one drop of blood in 25 gal (100 L) of water and can sense even tiny amounts of blood in the water up to 3 mi (5 km) away.

(sorry if this took a lot of time but i had search somethings)

Have a nice day!

Answer:

Sharks do not have bones. ... Most sharks have good eyesight. ... Sharks have special electroreceptor organs. ... Shark skin feels similar to sandpaper. ... Sharks can go into a trance. ... Sharks have been around a very long time. ... Scientists age sharks by counting the rings on their vertebrae. ... Blue sharks are really blue.Sharks, in some form or another, have been around for 450 million years. ... There are over 500 species of shark. ... Sharks do not have bones. ... The whale shark is the largest fish in the ocean. ... Another shark species is the hammerhead shark, known for its distinct appearance.

Explanation:

How do human lifestyles affect sustainability?

Answers

Answer: overpopulation, pollution, burning fossil fuels, and deforestation. Changes like these have triggered climate change, soil erosion, poor air quality, and undrinkable water.

Name one adaptation that allows desert plants to survive with little water?

Answers

Answer:

stomata

Explanation:

This adaptation helps cacti reduce water loss by keeping the hot, dry wind from blowing directly across the stomata. The leaves and stems of many desert plants have a thick, waxy covering.

What does the temporal lobe and Cerebellum do?

Answers

Answer:

The temporal lobes are also believed to play an important role in processing affect/emotions, language, and certain aspects of visual perception.

The cerebellum is busy planning, adjusting and executing movements of the body, the limbs and the eyes.

Explanation:

Which statement best explains why the classification
schemes of taxonomists have changed over time?
A. New technology like DNA sequencing allows scientist to have a more accurate genetic evolutionary history
B. New information about the genetics of species is being discovered.
C. Molecular biology has provided more detailed evidence for the relationships
between organisms.
D. All of the above

Answers

Answer:

D.

Explanation:

Sana tama kase feel ko pang

Classification of organisms is defined as dividing living beings into different kingdoms based on their genetics, traits, and other features.

Why did Classification Schemes of taxonomists change?

Taxonomists arrange and divide the organisms based on the DNA, traits, and features of the living organisms.

The advancements in technology led the taxonomists to have more information on genetic lineage and arrange them accordingly.

Introduction and discoveries of new species, their genetic make-up, and traits also contribute to the change of classification system.

Molecular biology, cellular level studies, and genetics of species have contributed to the classification of organisms.

Thus, the given statements about the classification of organisms are correct.

Learn more about the classification system here:

https://brainly.com/question/9046656

Help me please, I’m confused

Answers

Answer:

Photosynthesis-

Photosynthesis is a process used by plants and other organisms to convert light energy into chemical energy that, through cellular respiration, can later be released to fuel the organism's metabolic activities. Photosynthesis occurs in the chloroplast of a plant, which contains chlorophyll. In order for photosynthesis to take place, it needs to have water and carbon dioxide, the two very important raw materials necessary for this process. In the presence of carbon dioxide, such cells are able to convert this solar energy into energy-rich organic molecules, such as this energy-rich molecule known as glucose. Oxygen the by product of photosynthesis is inhaled by heterotrophs which aids in cellular respiration and other internal processes and then exhales carbon dioxide. ... In like manner, carbon dioxide passes from blood to the alveoli and exhaled after

Explanation:

The process by which organisms that are better adapted to their environment survive and reproduce more successfully than less well adapted
organisms do.
A. Artificial Selection
B.Evolution
С.Natural Selection
D.Adaptation

Answers

Answer:

C

According to Charles Darwin's theory of evolution by natural selection, organisms that possess heritable traits that enable them to better adapt to their environment compared with other members of their species will be more likely to survive, reproduce, and pass more of their genes on to the next generation.

Explanation:

Answer:

c.natural selection

Explanation:

A cell containing 20 chromosomes undergoes mitosis, each daughter cell will have 20 chromosomes
a.True
b.False

Answers

Answer:

the answer is true because a cell containing 20 chromosomes undergoes mitosis, each daughter cell will have 20 chromosomes

Tectonic plates can affect __________________ environmental changes, which might be a cause for species extinction

Answers

Answer:

I believe it is long term.

Explanation:

did it in edge 2020

Construct an argumentative paragraph. Do you believe it's ethical or unethical to artificially select traits in plants and or animals? Provide evidenco to suoport your claims. It doesn't matter what side you chose, but I need it asap.​I will give you any mark you want.​

Answers

Answer:

The ethics of artificially inserting traits in animals has been in the practice for years in the form of selective breeding, but should scientists really be editing DNA to the extent they are today? I don't believe they should. Life itself should construct itself without us interfering. Making a brand new plant just because it looks nice doesn't account for many factors, including the fact that it could be harmful to nearby plants if pollinated. In addition, generic engineering costs quite a lot of money, which should be used on other more cost effective methods, such as improving agriculture rather than creating a whole new plant that could harm entire crops. Genetic engineering isn't a necessity and humans should not play God with plant and animal life.

Why is the moon abiotic?

Answers

The moon is abiotic because it is a non living thing

Answer:

The moon is abiotic because it doesnt move and it's not a living thing.

The vocal cords stretch across the opening of the larynx. True or false??

Answers

Answer:

True

Explanation:

Vocal cords are bands of smooth muscle tissue located in the larynx. When air passes through, the vocal cords vibrate.

Answer: True

Explanation:

The vocal folds, also known popularly as vocal cords, are composed of twin infoldings of mucous membrane stretched horizontally across the larynx. They vibrate, modulating the flow of air being expelled from the lungs during phonation.

Consider two individuals that have the following genotypes: CCDd and Ccdd.
Predict the outcomes of a cross for these two individuals. What are the outcomes that could occur in the offspring? Select ALL that
apply.
A)
1/4 of the offspring will be CCdd.
B)
ccdd is not possible as an outcome of this cross,
All of the offspring will show the dominant trait for the allele.
D)
Only half of the offspring will show the dominant trait for the Dallele.
E)
All of the offspring will be heterozygous and will display the dominant
traits

Answers

Answer:

A,B,C,D

Explanation:

Since one parent is CC, there is no way to get cc as an outcome from this cross. However, there is also no way that all of the offspring will be CcDd, which is heterozygous for both traits. Therefore, this is the only answer choice that is incorrect.

As per observation about the  two individuals that have the following genotypes: CCDd and Ccdd the cross are options: a,b,c,d.

Since one parent is CC, there may be no manner to get cc as an final results from this cross. However, there may be additionally no manner that every one of the offspring could be CcDd, that is impure breed for each traits.

What is genotype ?

Genotype is an individual's series of genes. The time period can also talk to the 2 alleles inherited for a specific gene. The genotype is expressed while the statistics encoded within side the genes' DNA is used to make protein and RNA molecules.

Thus it is clear that all the observations are correct.

To learn about genotypes refer to the link ;

https://brainly.com/question/2235939

why are there 2 hydrogen atoms and only one oxygen

Answers

Answer:

Oxygen is an electronegative

Explanation:

Not only is it because in the chemical equation for water there is 2 hydrogen atoms and 1 oxygen atom, but they also share their electrons to fill their outermost levels and that are attracted together.

Hope this helps!!

WILL GIVE BRAINLIEST

DNA molecules are the instructions to make what?

-proteins

-carbohydrates

-lipids

-plasmids

Answers

Answer:

A

Explanation:

DNA is used to make mRNA, which is then used alongside tRNA to make a polypeptide chain. This chain folds to make a protein.

I hit a substance with a hammer and it shatters.It is a

Answers

Answer:

non metal ,so it is brittle in nature

The sun converts nuclear energy into what type of energy?

Answers

Answer:

i would say chemical but if im wrong im super sorry!!

Explanation:

HELP NEED THIS BY TODAY!
What did Mendel study that lead him to his discovery

Answers

Answer:

A monk, Mendel discovered the basic principles of heredity through experiments in his monastery's garden. His experiments showed that the inheritance of certain traits in pea plants follows particular patterns, subsequently becoming the foundation of modern genetics and leading to the study of heredity.

Explanation:

Answer:

Mendel studied the genetics of pea plants.

Explanation:

Mendel looked at the pea plants in his monastery garden to determine genetics. He found that some plants had white flowers, while some did not, and he used that discovery to determine the genetics of the plants.

What are some factors that can cause observed evolutionary change?

Answers

Answer:

There are four such forces: mutation, gene flow, genetic drift, and natural selection.

Explanation:

Answer:

natural selection, random genetic drift, mutation, population mating structure, and culture.

Explanation:

I hope this helps! ^^

☁️☁️☁️☁️☁️☁️☁️☁️

Virtual Lab
Active
Create a dichotomous key.
O
Magnifying Glass
Drag your question here.
Legs
Wings
Antennae
Stinget
Claws
Please help

Answers

Answer:

WHAT ARE YOU TRYING TO ASK BRO

NEED HELP ITS DUE AFTER MY WINTER BREAK!

Answers

Answer:

For question 1 the answer is respiratory, and for question 2 is circulatory

Answer: (1) Circulatory (2) Respiratory

which word refers to a substance that repels ( or is repelled ) from water
a - hydrophilic
b- hydrophobic
c- hydraulic
d- neo-hydro

Answers

Answer:

B- hydrophobic!

hope this helped you out! i would apreciate brainliest too:)

Explanation:

Can someone help me with this chromosome assignment?

Answers

this is the answer for only first page.

homologous, diploid,gametes,haploid

the same thing as what the other person said.

di=2

hap=1

remember that for diploid and haploid

Which statement best explains how the gases of the atmosphere affect the temperature of Earth?

Answers

The atmosphere today contains more greenhouse gas molecules, so more of the infrared energy emitted by the surface ends up being absorbed by the atmosphere. Since some of the extra energy from a warmer atmosphere radiates back down to the surface, Earth's surface temperature rises.

Fill in the blanks the world banks the word bank is on the picture provided below :)

Answers

Answer:

1 is pioneer species 2 is limiting factor 3 is ecological succession

Explanation:

Answer:

1) pioneer

2) limiting factor

3) ecological succession

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

Which feature of chytrids makes them different from the other types of fungi? the material that strengthens their cell walls the special digestive material they release their use of budding to reproduce their ability to live in dry environments

Answers

Answer:

the material that strengthens their cell walls

Explanation:

Chytrids originate from the kingdom fungi and a division known as Chytridiomycota. They contain a feature of unique characteristics by the presence of the chitin and the cellulose cell wall. The chitin made up the component of their cell wall in fungi but in Chytrids, the cellulose helps to strengthens their cell walls.

Answer:

A. the material that strengthens their cell walls

Please help!!!! Grizzly bears and polar bears are very closely related, so much so that they can reproduce to form hybrid offspring. Use your understanding of natural selection to describe how polar bears became a separate classification from the grizzly.

Answers

Scientists believe that at first these bears scavenged seal carcasses that had washed ashore, and gradually began to hunt the seals by waiting at the water's edge as the seals surfaced to breathe. This is believed to be an important step in the evolution of a new bear species, the polar bear

Over time the new polar bears were used to the cold climate and learnt how to fish, they then separated from the grizzly bears, they developed new creatures which would help them survive in one of the most dangerous climate.

Polar bears become separate classification from the grizzly by the natural selection known as divergent and adaptive evolutionary change.

Polar bears and grizzly bears are considered as closed to one another so they can interbreed. They both diverged from one another due to the harsh climate of the Arctic and the ecology of the region.

The changes that took place are camouflaging and pigment-free fur-coat that helped them in order to adapt to the different climates.The genetic mutation leads to such Adaptive changes when the polar bears migrated northwards.The populations living in different climates undergo natural selection that is divergent natural selection and the adaptive evolutionary changes that result in different species.

Learn more about speciation:

https://brainly.com/question/4493180

Other Questions
what is the solution of 4 + 5x + 68 = x + 10 White flower color is recessive to purple flower color in pea plants. If a pea plant has white flowers, what isthe genotype and phenotype of the pea plant help me please, lolllllllllllllllllll Plz help with all 3 questions i will give Brainliest Your grandfather has enjoyed good vision for most of his 80 years. You observe him having trouble reading websites on his new iPad, squinting while he moves it towards and away from his face. You realize he might benefit from reading glasses. Since you were going out anyway, you offer to pick up a pair of glasses for him at the drug store. Consider that your grandfather is at his most comfortable reading posture when he is holding the iPad at a distance of 18 inches.a. What dioptric power of reading glasses should you get for your grandfather? Note that reading glasses are normally available in increments of 0.25 Diopter.b. It occurs to you that you could have just shown grandpa how to make the displayed content appear larger on the iPad by adjusting the display "zoom". What percentage zoom (100% is the default view, 200% would make text and images twice as large) would give your grandfather a similar viewing experience to wearing the reading glasses you were planning to purchase? According to economists, all humans have their own "rational self-interest." What does this mean?A.) They want to help others rather than help themselves.B.) They will only make rational and logical decisions about purchases.C.) They want to benefit themselves as much as possible. D.) They will only make a purchase if it is involving their top three interests. Why did the U.S. government use rationing for some foods and consumer goods during World War II? Dona is attempting to make an electromagnetic to pick up old nails in her driveway. Which of these materials would be best to us for the core to make the strongest electromagnetic to pick up the most nails? EXERCISE B: Identifying verbal and non-verbal phrases.Fill in the grid below using expressions inside the box.1. Shut up and let me finish!2. (Derisive laughter).3. (Move closer to the speaker)4. Just a minute, please.5. Signal "stop" with hand.6. (Tiger look)7. (Talk louder)8. Please don't interrupt me.9. (Angry face)10. How are you today?Non-verbalVerba! A medical provider is doing a study to determine the average time spent waiting before an appointment. The current average wait time is 34 minutes, which is 15% shorter than the average was when the study started. What was the average wait time then? Christianity believes that Judaism is false and all Jewish ideals should be ignored.True or False Consider C = {vowels in the word "clinic"}. Find n (C)A. 6B. 4C. 2D. 12 PLS PLS PLS THIS IS VOCAB FOR MATH ONLY HAVE UNTILL 7:30 TO DO SEVERAL ASSIGHNMENTS1. a number belonging to the set made up of the counting numbers: 1, 2, 3, and so on 2. a number that is greater than zero 3. a line that graphically represents all numbers 4. a pair of numbers whose sum is zero 5. any number belonging to the set of counting number, or zero 6. a number that is less than zero 7. a number belonging to the set made up of the whole numbers and their opposites 8. two numbers that are the same distance from zero on the number line but in opposite directions What kind of questions do scientists ask?A. Ones that there are no right answers toB. Ones that only deal with scientific issues C. Ones that deal with matters of opinion D. Ones that are answered through observing How do mosses and ferns reproduce?with sporeswith seedswith eggswith spermI think the answer is -> SPORES The map below shows major ocean currents in the North Atlantic and North Pacific Oceans. In general, currents flowing toward theEquator bring cooler waters to some regions, while currents flowing away from the Equator bring warmer waters to other regions.NorthBritishIslesAskanNorth AtlanticAzorU.S.ACaliforniaGulf StreamLoopnCanbeanNorth EquatorialNorth Equatorial CCNorth FuatorialEquatorSouth EquatorialNotSouth EquatorialImage courtesy of NOAAJudging from the map, which region probably has cooler summers than it would without the effect of a nearby ocean current?A the Central U.S.B. the British IslesC. the U.S. East CoastD. the US West Coast Part 1* are a nouns action ( ) are somebody's thoughts Normal text is talking CAPITALIZED TEXT is shouting *crash* *stumble* Jai- *He runs as fast as he can from the three guards chasing him, he looks back and forth pulling his black cape back onto his ears. * Guard #1- HEY YOU COME BACK HERE!!! *slowing from exhaustion* (How does guy run so quickly. He looked a little shady before but now somethings definitely off.) Guard #2- SPLIT UP!! *Hes out of breath and falling behind* Jai- *jumps up onto a dumpster and then a roof then continues to jump on the line of buildings* *nervously laughs* (that was really close royal guard almost immediately jeez I just snuck into the kingdom) *spots a doorway and slips in* Guard #3- Guys hes gone *pulls off helmet and shows her long brown hair* *revealing that its Red* Please help me translate this from Spanish to English!! 6. What direct object pronoun in French would replace "Pauline et toi"nouslesvousme A car is moving with 15000J of energy. If the car has a mass of 1500kg, how fast is it moving?