3. Compare and contrast the movement produced by each of the three types

Answers

Answer 1

Answer:

strike-slip is when the blocks have mostly moved horizontally, normal is when a dip-slip fault in which the block above the fault has moved downward relative to the block below, and thrust is when the hanging wall moves up relative to the footwall.

Answer 2

There are three faults. Normal faults originate from the divergent boundary. Reverse faults originate from the convergent boundary. Strike-slip fault originate from transforming boundary.

What are the three types of fault?

We can differenciate three types of faults,

Normal fault ⇒ originate from divergent movementReverse fault ⇒ originate from convergent movementStricke-slip fault ⇒ originate from transforming movement

What are the boundary types?

I. Divergent:

This boundary occurs when two plates separate and molten material rises from the mantle creating a new crust.

The hot material creates a new seabed between the separating plates, expanding the sea bottom.

II. Convergent.

Collision area between two plates. Two oceanic plates might collide, or one oceanic plate with a continental one.

In this last case, the oceanic crust sinks under the continental plate, and magma rises to the surface by crevices.

The thicker and older plate subduces under the other plate.

III. Transforming.

The plates slide laterally with each other, and they are usually called faults.

It is associated, in general, with the oceanic ridge, although it might also occur in the continental plate.

No rocky material is either destroyed or formed.

When the plates move and produce a displacement of one transforming limits from side to side, earthquakes occur.

The movement breaks the crust and originates pronounced fractures.

You can learn mor about the movement produced by the three types of faults at

https://brainly.com/question/8548987

https://brainly.com/question/15441752

#SPJ2


Related Questions

Graded for correctness: In humans, the ability to digest lactose beyond childhood is determined by a single gene on chromosome 1. L denotes the allele that gives the ability to digest lactose and l denotes the inability to digest lactose. On chromosome 3 is the gene for widows peak. A denotes the allele for no widows peak and a denotes a widows peak. A woman volunteers to be a participant in a genetic research study. Her genotype is LlAa. A doctor harvests a single egg from her body. The genotype of her egg is LA. How did her chromosomes line up at the metaphase plate during meiosis

Answers

Answer:

Metaphase I:    

Homologous chromosomes are placed in the equatorial planeChromosomes carrying the dominant alleles, L and A, face one of the polesThe homologous chromosomes, carrying the recessive alleles, l and a, face the opposite pole.

Metaphase II:  

Chromosomes carrying the dominant alleles, L and A, are placed in the equatorial planeOne of the chromatid sisters of each chromosome faces one of the polesThe other chromatid sisters of each chromosome face the opposite pole.

You will find the image in the attached files.

Explanation:

During metaphase I, homologous pairs migrate to the equatorial plane. They randomly aline with their kinetochores facing opposite poles. The random arrangement of tetrads is different in every cell going through the meiosis process. There is no equal alinement between two cells. When tetrads aline in the equatorial plane, there is no predetermined order for each of the homologous chromosomes of each tetrad to face one of the poles and then migrate to it while separating. Each of the chromosomes has two possibilities for orientation at the plane. When the new haploid cells are formed, the number of variations in each cell is also different and depends on the chromosomes that form that cell. This random order in the equatorial plane is what introduces variation into the gametes. It is almost impossible that two gametes resulting from meiosis will get the same genetic charge.

During metaphase II, fibers of the spindle apparatus take chromosomes toward the equatorial cell plane, where they line up. Sister chromatids are holden together until they reach the Anaphase, during which specialized enzymes break the bonds between chromatids and separate them. Each chromatid migrates to one of the poles. In telophase, the new chromosomes are already in the corresponding poles, and the nuclear membrane forms again. Finally, cytokinesis occurs.

In this example, we will assume no crossing-over in the prophase. I will propose the two metaphase stages.

Metaphase I:                                   Pole 1

        Chromosome 1   ---------L----                -----------A---------    Chromosome 3

                                    ----------L----               -----------A---------

Equatorial plane.....................................................................................................  

        Chromosome 1   ---------l----                  -----------a---------    Chromosome 3

                                     ---------l----                  -----------a---------                      

                                                           Pole 2

In this scheme of Metaphase I, homologous chromosomes are already aligned in the equatorial plane. Each homologous chromosome is facing a pole. So, in the superior part of the scheme, we have chromosomes 1 and 2 carrying the dominant alleles L and A. Both chromosomes are facing pole 1. Then, we can recognize the equatorial plane, and on the other side, we find the homologous chromosomes 1 and 2, facing pole 2, and carrying the recessive alleles, l and a.

During anaphase I, homologous chromosomes will separate and migrate to different poles. In this example, we are interested in chromosomes carrying the dominant alleles that migrate to pole 1. LL and AA.

Metaphase II:                                 Pole 1

        Chromatid 1   ---------L----                    -----------A--------  Chromatid 3

Equatorial plane.....................................................................................................  

        Chromatid 1   ----------L----                   -----------A---------  Chromatid 3

                                                         Pole 2

During metaphase II, each chromatid sister carrying the dominant alleles faces a different pole. During anaphase II they separate and migrate again.

The total result of meiosis in this particular cell is the formation of 4 haploid cells -gametes-: LA, LA, la, la

How does competition limit the amount of individuals in populations?

Answers

Answer:

Due to competition, many animals starve, many become prey, etc.

Explanation:

A one-hectare forest community is sampled in early August. The sample yields 12 small trees, 4 types of vines, as well as 17 native shrubs that represent 10 species. What can be estimated from the sample for the shrubs in the forest community?

A. the forest’s productivity

B. the species richness

C. the degree of forest disturbance

D. the stability of the ecosystem

E. the uniformity of species distribution in the ecosystem

Answers

Answer:

The correct answer is - B. the species richness

Explanation:

Species richness determines the numbers of different species are present in an ecological community. It is a numerical value or count of different species present in a particular community.

The given information or data can only be used to estimate the species richness in the particular forest community as there is data available about the number of species presnt in this community.

1) Read the following paragraph and answer the following questions.
The countries which do not have oil reservoirs in their land, import oil from other countries. But sometimes during transportation of oil through sea routes, accidental oil spill occurs. This oil spilled in the ocean may prove fatal and toxic to aquatic animals. Therefore, removal of this spilled oil is essential for protection of aquatic life. For removing this oil layer, certain microbes like Pseudomonas spp and Alcanivorax borkumensis are used. These microbes have the ability to destroy the pyridines and other toxic chemicals. The hydrocarbonoclastic bacteria (HCB) are able to decompose the hydrocarbons and bring about the reaction of carbons with oxygen resulting in formation of CO​2​ and water. Like oil spills cause damage

to aquatic life, plastic forms the major part of the garbage on the land. Plastics are difficult to degrade as they are made up of PET, by research various species like Vibrio and Ideonella sakaiensis which can degrade PET have been identified. There are certain species of microbes which can decompose rubber from garbage.
a) How are aquatic organisms affected by oil spills in the ocean?
b) Which type of chemical compounds are degraded by microbes used for
clearing oil spills?
c) Name any two species of microbes which can degrade rubber from
garbage.
d) Why should there be a ban on plastic bags?

Answers

Answer: See explanation

Explanation:

a) How are aquatic organisms affected by oil spills in the ocean?

Aquatic organisms are affected by oil spilled as it is fatal and toxic to them. It can cause death, habitat degradation, vulnerability to predators and can also lead to the inability to hatch their eggs.

b) Which type of chemical compounds are degraded by microbes used for

clearing oil spills?

The chemical compound degraded by microbes are clearing oil spills are Pseudomonas spp and Alcanivorax borkumensis.

c) Name any two species of microbes which can degrade rubber from

garbage.

These are Vibrio and Ideonella sakaiensis.

d) Why should there be a ban on plastic bags?

There should be a ban on plastic bags as they're difficult to degrade as they are made up of PET.

Hitchhiker’s thumb (H) is dominant to no hitchhiker’s thumb (h). A woman
who does not have hitchhiker’s thumb marries a man who is heterozygous for
hitchhiker’s thumb. What is the probable genotypic ratio of their
children?
Group of answer choices

50% Hh : 50% hh

100% HH : 0% hh

75% Hh : 25% hh

0% Hh : 100% hh

Answers

Answer:

there is a 50 50 chance

Explanation:

have a nice day!;)

The probable genotypic ratio of their children is 50% Hh : 50% hh because the man is heterozygous for the hitchhiker’s thumb, hence option A is correct.

What is a heterozygous condition?

In some crosses, there are two conditions, in which some alleles are heterozygous and some are homozygous. In the homozygous trait, both alleles are the same, it may be dominant or recessive HH and hh, respectively.

The cross is between a woman who does not have a hitchhiker’s thumb and a man who is heterozygous for a hitchhiker’s thumb.

 

Cross: Hh X hh

Gametes: H and h

Genotype: Hh, Hh, hh, hh  

Phenotype: 50% of hitchhiker’s thumb and  50% not having hitchhiker’s thumb.

The cross is attached in the image below.

Therefore, due to the heterozygous condition of man genotypic ratio of their children is 50% Hh: 50% hh.

Learn more about heterozygous, here:

https://brainly.com/question/14584278

#SPJ2

3. In the image, which letter represents the enzyme?
a. Letter A
b. Letter B
c. Letter C
d. Letter D

Answers

Answer: The answer is C

Explanation:

The correct option is, (c) Letter C.

What is the enzyme?Proteins called enzymes assist our bodies' chemical reactions move forward more quickly. For several processes, including digestion and liver function, enzymes are crucial. Health issues might result from having too much or too little of a specific enzyme. Healthcare professionals can also use the enzymes in our blood to look for injuries and illnesses.

How do you classify enzymes?

According to the sort of process they catalyze, enzymes are divided into six categories:

Oxidoreductases. Transferases.Hydrolases.Lyases.Ligases.Isomerases.

What are the 7 enzymes?Depending on the type of reaction they catalyze, enzymes can be divided into seven different types. These groups include hydrolases, lyases, isomerases, ligases, translocases, oxidoreductases, transferases, and hydrolases.

What is enzyme structure?Proteins called enzymes are made up of amino acids connected by one or more polypeptide chains. The fundamental structure of a polypeptide chain refers to this arrangement of amino acids. This in turn dictates the enzyme's three-dimensional structure, including the active site's shape.

Learn more about enzyme here:

https://brainly.com/question/1596855

#SPJ2

Vacuoles are found in plats, animals, and single-celled organisms.
In plants, vacuoles can occupy up to 90% of the cell while in animals, vacuoles are much
smaller and also help store ions and nutrients.
Single-celled organisms that live in aquatic environments like the paramecium, have a
contractive vacuole to maintain homeostasis.
Based on the information given, how does a vacuole help an organism maintain homeostasis?
A. It helps by regulating water amounts within the cell.
B. It helps by keeping a rigid structure at all times,
C. It helps by excreting salt as part of osmosis
D. It helps by controlling the movement of gases into the cell.

Answers

Answer: c

Explanation: because it helps by excreting

which are examples of steroids? A. testosterone and trans fats B. cholesterol and phospholipids C. cholesterol and vitamin D D. estrogen and phospholipids

Answers

Answer:

A

Explanation:

because it really is suppose. to make u more stronger tougher and high testosterone.

In the 1860s Gregor Mendel performed numerous dihybrid crosses between pea plants. Dihybrid crosses involve the study of the inheritance patterns related to two different traits. In guinea pigs the allele for black fur (B) is dominant over the allele for brown fur (b), and the allele for short fur (F) is dominant over the allele for long fur (f). What percentage of the offspring from a BbFf x bbff cross would be expected to be heterozygous for both traits

Answers

Answer:

25% of the progeny is expected to be dihybrid, BbFf, expressing Black and short fur

Explanation:

Available data:

the allele for black fur (B) is dominant over the allele for brown fur (b)the allele for short fur (F) is dominant over the allele for long fur (f)Cross: BbFf x bbff

Parentals)            BbFf      x         bbff

Phenotypes) Black/Short    Brown/Long

Gametes)       BF, Bf, bF, bf      bf, bf, bf, bf

Punnett square)      BF         Bf          bF          bf

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

F1) 4/16 = 1/4 = 25% of the progeny is expected to be dihybrid, BbFf, expressing Black and short fur

    4/16 = 1/4 = 25% of the progeny is expected to be bbFf, expressing Brown and short fur

    4/16 = 1/4 = 25% of the progeny is expected to be Bbff, expressing Black and long fur

    4/16 = 1/4 = 25% of the progeny is expected to be bbff, expressing Brown and Long fur

Answer:

25%

Explanation:

Because i took the test

Explain why only certain substrate can combine with enzymes.
Help me please​

Answers

Answer:

sry i cant i too dubm need points tho

Explanation:

issues of food insecurity in high income countries​

Answers

Not sure i guess people are just insecure to eat in front of people

Describe some of the changes in the land and in life-forms that occurred at the end of the Paleozoic Era.

Answers

during the end of the paleozoic era it was probably one of the greatest mass extinctions on earth and the land started to break up and move around to form what the world looks like today

What nitrogen base does Cytosine pair with

Answers

Answer:

Guanine

Explanation:

There are four nitrogenous bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine)

Adenine always bonds with thymine, and cytosine always bonds with guanine.

Match each idea about evolution to the person or group where it originated from the drop down menu

Answers

Hello. You did not present the ideas about evolution to which the question refers, which makes it impossible for your question to be answered. However, I will try to help you in the best possible way, showing you the main ideas about evolution and the people who originated them.

According to Jean-Baptiste organisms evolve as a way of seeking perfection.

According to the ancient Greeks and Romans, all living things are in a constant process of change. This change causes evolution and when a living being evolves it causes the evolution of another living being, since everyone is connected and related.

According to Darwin, evolution occurs over time and through an ancestor. For him All living beings have a common ancestor, which evolved over time and generated new species. Darvin also believes that any characteristic acquired by evolution could be passed on to the descendants.

According to Malthus, living beings generate a number of descendants disproportionate to the resources necessary for their survival and this causes evolution.

The behavior of an organism is influenced by both internal and external factors. How might a bear be influenced by external factors in its environment? A. A decrease in the number of fish causes bears to start consuming more plants. B. An increase in hunting causes bears to stay in covered areas and avoid humans. C. A decrease in temperature causes bears to look for food during the day instead of at night. D. all of these

Answers

Answer:

D. all of these

Explanation:

I just got it right in study island (:

Answer:

it's D

Explanation:

What type of graph is used for a PH test

Answers

Explain why a line graph is used for the pH data. Line graphs are utilized when data is continuous. It’s either a line graph or bar graph but usually line graph

The shark still has identical skeleton to previous sharks. What other way can you prove evolution occurred if fossil evidence does not show any?

Answers

There is biogeography comparative and anatomy and comparative embryology and molecular biology

Question 1. What change led to an increase in the number of light-colored moths within the population?
1. More mutations
2. Decreased pollution
3. More dark colored trees
4. Fewer humans

Question 2. Claim: Individuals in a population have genetic variations that can be passed on to their offspring. Refer back to the rabbits in the desert from the natural selection activity we did in class. How could an organism's traits influence the survival rate of the population?

Answers

Answer: 1. 1. More mutations. 2. According to Charles Darwin's theory of evolution by natural selection, organisms that possess heritable traits that enable them to better adapt to their environment compared with other members of their species will be more likely to survive, reproduce, and pass more of their genes on to the next generation.

Explanation:

Which statement is true of reproduction that
involves two parents?
O A. Offspring are exact copies of the parent.
O B. Each parent provides the offspring with
genetic material.
O C. Single cells reproduce in this way.
O D. Bacteria reproduce in this way.

Answers

The answer is B, because each parent provides offsprings with genetic material with background coming from both parents which is how DNA forms and copy molecules.

6. Your friend is trying to gain some more muscle and has started lifting weights.
You read that muscle structure is primarily built by putting amino acids together through protein synthesis.
What foods should you recommend to your friend, so that they can increase the amount of amino acids in their diet?
1. Identify a food from the selection that they should eat.
2. Explain how you know that food has the macromolecule they need.

Answers

Answer:

He should start out doing little amount , any workout his wants but try to hold the weight for 1 min , making sure that he doesn't lift too fast instead he should do them slow and hold it for a while for he can feel the burn in his muscle and with time add the reps and hold it longer

Explanation:

I need help with this

Answers

Answer:

what is the name of this website

or the book?

help please 30 points will give brainliest
Plants release the waste ___________ during cellular respiration and ____________ during photosynthesis.

fill in the blanks

Answers

Plants release the waste carbon dioxide during cellular respiration and oxygen during photosynthesis.

5 5. Normally, the temperature inside the scrotum is slightly lower than normal body temperature. What do you predict would happen if the temperature inside the scrotum were a few degrees higher than normal body temperature instead? A. Sperm would not be able to travel through the vas deferens. B. Sperm would be stored in the epididymis rather than in the testes. c. Sperm would not be able to develop properly. D. The rate of sperm production would increase,​

Answers

Answer:

C. Sperm would not be able to develop properly.

Explanation:

There is an optimum temperature where sperm production is at its best. An increase or decrease in temperature may affect the quality and quantity of the sperm.

If the temperature inside the "sc-rotum" raises by few degree than normal body temperature, than the "sp-erm" would not be able to develop properly.

What is the function of "sc-rotum"?

A pouch, which is suspended from the groin, and comprising the "tes-tes" and some of the male "s-ex" accessory ducts is known as the "sc-rotum". The prime function of the "sc-rotum" is to maintain the temperature essential for the process of "sper-matogenesis", that is, by situating the testes external of the body cavity.

Within the human "sc-rotum", the temperature is 3.1 degree C lesser than the usual temperature of the body. In case, if the temperature elevates of the "sc-rotum", the degeneration of the germinal epithelium will take place, which will eventually result in sterility. Therefore, for the production of sperms within the testes, a lower temperature is needed, otherwise the development of the "sp-erm" will not take place appropriately.

Thus, the correct answer is option C.

Find out more information about the function of "sc-rotum" here:

https://brainly.com/question/940283

how do the two sets of muscles work together to make air enter the lungs

Answers

Answer:

Here you go

Explanation:

downward toward the abdomen, and the rib muscles pull the ribs upward and outward. This makes the chest cavity bigger and pulls air through the nose or mouth into the lungs.

ANSWER ASAP:
What are the basic
needs of humans? What are basic needs of
animals? How are these similar or different?

Answers

Answer: 1. Human beings have certain basic needs. We must have food, water, air, and shelter to survive. If any one of these basic needs is not met, then humans cannot survive.  2. In order to survive, animals need air, water, food, and shelter (protection from predators and the environment); plants need air, water, nutrients, and light. Every organism has its own way of making sure its basic needs are met. 3.Humans and Animals both have similar social skills. ...

We have facial expression similar to that of a mouse. ...

We talk things while sleeping just like dolphins. ...

Just like Humans, Cows also have regional accents. ...

Dolphins, just like Humans get occasionally high.

Explanation:

Can throat cancer be inherited?

Answers

Most throat cancers are generally related to smoking and not hereditary, unless the family members are predisposed to smoking.

No not really. Only genes

Help!!
Cells of the skeletal system are specialized in their structure to store minerals. Which of the following is the function of these cells?

Produce chemicals that transmit signals.

Prevent the spread of disease in the organism.

Provide support to the body.

Absorb excess water released by digestion.

Answers

Answer: Provide support to the body.

Explanation:

The skeletal system is a system which is formed by the bones. The bones are important for the structure and function of the body. The bones are connected with the muscles to allow the movement of the body, and they protect the vital organs like heart, lungs, brains, and others. They provide support to the soft tissues, organs, and muscles of the body. They keep the human body upright. The skeletal system provide shape to the body. It provides support by acting as regions of attachment of soft body parts and muscles.

Meiosis and Mutations are both sources of/for:
O Genetic Drift
O Polyploidy
O Mutations
Genetic Diversity

Answers

Answer:

genetic drift

please mark as brainlest

Determine the mRNA and amino acid sequence for the below DNA sequence.

Answers

AUGAGCCCCGCUAGGUUCUC

What changes occur in taste receptors when the membrane is depolarized during receptor potential A. Voltage-gated Ca2 channels open, triggering the release of neurotransmitter. B. Voltage-gated Cl- channels open, triggering the release of neurotransmitter. C. Voltage-gated Ca2 channels open, inhibiting the release of neurotransmitter. D. Voltage-gated Cl- channels open, inhibiting the release of neurotransmitter.

Answers

Answer:

A. Voltage-gated Ca² channels open, triggering the release of neurotransmitters.

Explanation:

For taste mechanisms to function properly, it is necessary the activation of taste receptors.  

Through the activation of taste receptors, transduction cascades occur, involving ion channels that are located in the apical or lateral membranes. There occurs a subsequent release of chemical neurotransmitters that send signals to the control centers.

Salty and sweet flavors produce the membrane depolarization that results in Ca+ ions´ entrance to the cell. Ca+ initiates the release of neurotransmitters. Afferent gustative neurons receive the message and send it to the control center, the encephalon. After that, gustative cells go back to the initial state, repolarizing.

Other Questions
Yo____ las instrucciones A. SigoB. Siguo Which organism obtains energy without directly depending on another organism C(4,4)D(-8,0B(6, -2)A(-6, -6) On January 1, Year 2, Kincaid Company's Accounts Receivable and the Allowance for Doubtful Accounts carried balances of $76,000 and $4,000, respectively. During Year 2, Kincaid reported $215,000 of credit sales, wrote off $2,100 of receivables as uncollectible, and collected cash from receivables amounting to $271,100. Kincaid estimates that it will be unable to collect one percent (1%) of credit sales. What effect will the entry to recognize the uncollectible accounts expense for Year 2 have on the elements of the financial statements summarize the TWO fields of study below: (a)Archaeology (marine,forensic, act). (b) Museum management and curatorship 2.) Dolly Parton is best known for O TRIO records O Blues music O Rock and Roll music O Mountain music The population of a city decreases by 4% per year. If this year's population is 171,000, what will next year's population be, to the nearest individual? Always in the game and never played by the rules (rules)Tried to let me leave (leave), fell down to my knees (knees)Picked myself up and turned my back to the breeze, oh-ohSpent a milli' on a milli', mama look at me (oh)With all these diamond chokers, man, it's gettin' hard to breathe Which expression represents the distance between the two numbers on thenumber line?a. -1 + 2.5b. -1 -2.5 c. 12.5 - (-1) d. 12.5 -11 Which phrase from the poem makes something seem human? A. it soars along the doves B. wraps you up in a velvet sheet C. reaches you through all the walls D. flutters like a butterfly ,........................................................................................l Expliquez les diffrents sens du mot crateur selon son contexte a) c'est une robe de crateur b) il est le crateur de la carte SD c) le crateur de cette oeuvre est il encore vivant ? d) d'apres ce texte sacr, un crateur celeste rgne sur les humains Please help Thanks besties A taxi driver wrote a formula to represent the mileage and fee for his last customer. He wrote the equation 3.00 + 0.50 m = 9.50, where m represents the number of miles traveled.Which statement shows the meaning of the drivers equation? Select two options.Three dollars added to $0.50 is the same as $9.50.Three dollars plus $0.50 times the number of miles is equal to nine dollars and fifty cents.Three dollars more than the quotient of $0.50 and the number of miles is nine dollars and fifty cents.The product of the number of miles and the sum of $3 and $0.50 is equal to $9.50.The sum of three dollars and the product of 50 cents times the number of miles is nine dollars and fifty cents. help js zoom in to see the question and answers Can somebody please help me with this question? im need help please!!! PLEASE HELP! IM LIKE STUCK AND I NEED HELP! YOU'LL GET 50 POINTS !!!! What is one end of a magnetized compass's needle attracted to? Why is it important to organize your photos on your computer? A. to keep the file sizes small B. to adjust the exposure C. so that you can easily find them D. so that you have more than one copy in case something bad happens to your computer