2
A sample of water has a volume of two liters and is shaped like a cylinder in one container. In a much larger container, the water
still has a volume of two liters, but it is shaped like a rectangle
What state of matter is the water in?
OA. Solid
OB. magnetic
OC. plasma
OD. liquid
Reset
Submit

Answers

Answer 1

Answer:

D. liquid

Explanation:

Matter, which is any substance that has weight and occupies space, can exists in three states namely: solid, liquid and gaseous. In this question, water is being described as matter.

According to this question, a sample of water of volume 2litres is shaped like a cylinder in one container and shaped like a rectangle in another larger container. Based on this observation, the water sample is in a LIQUID STATE because a liquid has no indefinite shape but takes the shape of its container.

Hence, this water sample, takes the shape of its cylindrical container in the first scenario and shape of its rectangular container in the second scenario.


Related Questions

A mass m of water is at a temperature of 290K. The specific heat capacity of water is c. Ice, at its melting point, is added to the water to reduce the water temperature to the freezing point. The specific latent heat of fusion for ice is L. What is the minimum mass of ice that is required

Answers

Answer:

17 mc/L

Explanation:

We habe heat that is taken by the ice for it to melt to be equal to the heat given by water.

ML = mc(290K - 273K)

ML = mc 17

Then we divide through by L

M = 17 mc/L

Please note that 273k as we have used in thIs solution is the temperature at which we can have water to freeze

Therefore the minimum mass of required ice = 17 mc/L

3
Directions: Drag each tile to the correct box.
Three phases of waler are shown below.
Put the phases in order from fastest particle molion to slowest particle molion.
liquid water
>
steam
ice
Reset
Submit

Answers

Answer:

In order from fastest to slowest, Steam > Liquid Water > Ice

Explanation:

As temperatures rise, particles are allowed to move faster and more freely. If you think about the phases of matter, the more compact something is (solids), the less the particles are able to move. Taking the temperate of ice into consideration, the cold further restricts fast movement of particles, whereas gas (especially steam in this case), in hot temperatures, is able to move quickly and freely in the atmosphere.

And electro chemical cell has the following standard cell notation:
Mg(s) | Mg2+ (aq) || Ag+(aq)| Ag(s)

Write a balanced redox reaction for the cells using the oxidation and reduction half reactions. (be sure to equalize charge by multiplying the correct number before adding and simplifying)

Answers

2Ag⁺(aq) + Mg(s)→ 2Ag(s) + Mg²⁺ (aq)

Further explanation

Given

Standard cell notation:

Mg(s) | Mg2+ (aq) || Ag+(aq)| Ag(s)

Required

a balanced redox reaction

Solution

At the cathode the reduction reaction occurs, the anode oxidation reaction occurs

In reaction:  

Ag⁺ + Mg → Ag + Mg²⁺  

half-reactions

at the cathode (reduction reaction)

Ag⁺ (aq) + e⁻ ---> Ag (s)  x2

2Ag⁺ (aq) + 2e⁻ ---> 2Ag (s)

at the anode (oxidation reaction)

Mg (s) → Mg²⁺ (aq) + 2e−

a balanced cell reaction

2Ag⁺(aq) + Mg(s)→ 2Ag(s) + Mg²⁺ (aq)

Answer:2Ag⁺(aq) + Mg(s)→ 2Ag(s) + Mg²⁺ (aq)

Explanation:

just took test

What is the molarity of a solution of 10% by mass cadmium sulfate, CdSO4 (molar mass = 208.46 g/mol) by mass? The density of the solution is 1.10 g/mL.

a. 0.528 M
b. 0.436 M
c. 0.479 M
d. 0.048 M
e. 22.9 M

Answers

Answer:

a. 0.528 M .

Explanation:

Hello!

In this case, since the given by-mass percent can be written as:

[tex]\frac{10gCdSO_4}{100g\ sol}[/tex]

By using the density and molar mass of the solute, cadmium sulfate, we can compute the molarity, by also making sure we convert from mL to L of solution:

[tex]M=\frac{10gCdSO_4}{100g\ sol}*\frac{1molCdSO_4}{208.46gCdSO_4} *\frac{1.10g\ sol}{1mL\ sol}*\frac{1000mL}{1L} \\\\ M=0.528M[/tex]

Thereby, the answer is a. 0.528 M .

Best regards.

The molarity of the solution of 10% by mass cadmium sulfate [tex](CdSO_4)[/tex] is approximately 0.479 M. The correct option is C.

To calculate molarity we need to find out how many moles of CdSO4 are present in the solution.

Given:

Mass of [tex]CdSO_4[/tex]= 10% by mass of the solutionMolar mass of [tex]CdSO_4[/tex] = 208.46 g/molDensity of the solution = 1.10 g/mL

We need to calculate the mass of [tex]CdSO_4[/tex]:

Mass of [tex]CdSO_4[/tex] = (10% / 100%) * Total mass of the solution

Mass of [tex]CdSO_4[/tex] = (10 / 100) * 1000 g (since the volume is 1 L, and the density is 1.10 g/mL)

Mass of [tex]CdSO_4[/tex] =  100 g

So, the number of moles of CdSO4:

Number of moles of [tex]CdSO_4[/tex] = Mass of CdSO4 / Molar mass of CdSO4

Number of moles of [tex]CdSO_4[/tex] = 100 g / 208.46 g/mol

Number of moles of [tex]CdSO_4[/tex] ≈ 0.479 moles

Then, we calculate the molarity of the solution:

Molarity = Number of moles of CdSO4 / Volume of the solution (in liters)

Molarity = 0.479 moles / 1 L

Molarity ≈ 0.479 M

Hence, the molarity of the solution of 10% by mass cadmium sulfate [tex](CdSO_4)[/tex] is approximately 0.479 M. The correct option is C.

Learn more about Molarity, here:

https://brainly.com/question/31545539

#SPJ6

bill nye chemical reactions:

the picture looks cut off but can someone please help!

Answers

Answer:

. A(n) _______________________________ is matter that is composed of 2 or more different kinds of atoms.

2. A chemical reaction in which energy is released/given off is _____________________________________.

3. A(n) _________________________________ is a process in which substances are changed into other

substances.

4. Matter that is composed of only 1 kind of atom is a(n) ______________________________.

5. ___________________ is the ability to do work and/or transfer heat.

6. A chemical reaction in which energy is absorbed/taken in is _______________________________.

Knew/New

Write down 3 things you already knew about chemical reactions that were confirmed through watching the

video:

1.

2.

3.

Write down 3 new things that you learned from watching the video:

1.

2.

3.

Episode Guide

1. Chemicals can react to form new _________________________________.

2. Chemical reactions happen when ____________________ hook together.

3. Energy is given off during a chemical reaction because ____________________ are combining with other

__________________________.

4. During the "Try this" experiment, we see the students using vinegar and salt to clean old copper pennies.

The copper gets stripped away and the pennies look new again. Explain why you think this happens.

__________________________________________________________________________________________

Answer Key

compound

exothermic

chemical reaction

element

Energy

endothermic

Answers will vary.

Answers will vary.

chemicals

electrons

electrons

electrons

Copper atoms in the penny react with oxygen atoms from the air & together they form copper oxide which

makes the pennies look dull and dirty. The copper oxide dissolves in a weak acid (the vinegar & salt).

5. When vinegar and baking soda react together, the new substance that is produced is ___________________.

6. _______________ & ______________ are both dangerous by themselves, but when they react together they

form table salt.

7. Pyrotechnician is a name given to people who work to create _________________________.

8. In another experiment, we see kids blow up a balloon by mixing together vinegar and baking soda. When

the kids touch the blown up balloon, it is ____________ to the touch. This means that the reaction is

endothermic or exothermic

9. When someone gets hurt playing sports, often times a cold pack is used for the injury. The cold pack takes

up more energy than it gives off and it gets very ___________ to the touch. This means that the reaction taking

place is endothermic or exothermic

10. How do you know baking a cake is a chemical reaction? ________________________________________

11. There are ___________ naturally occurring elements.

12. If elements are in the same group on the periodic table, what does that tell you? ______________________

__________________________________________________________________________________________

True or False

1. When something burns, heat & light are given off. T or F

2. Your stomach growling is an example of a chemical reaction. T or F

3. Water is 1 part hydrogen and 2 parts oxygen. T or F

4. When baking a cake, a chemical reaction takes place. T or F

5. Everything is made of chemicals. T or F

6. Alfred Nobel invented dynamite. T or F

7. You should always wear safety goggles when working with chemicals. T or F

8. Sodium chloride is better known as sugar. T or F

9. A substance can feel a little warm if the reaction is endothermic. T or F

10. When developing film, red light doesn't affect the picture. T or F

11. A cold pack gets cold because the reaction takes more energy than it gives off. T or F

12. If chemicals behave similarly, they are grouped together on the periodic table. T or F

13. Chemical reactions happen when protons link atoms together. T or F

14. When vinegar and baking soda react, oxygen is produced. T or F

15. Fireworks are not an example of chemical reactions. T or F

carbon dioxide

Sodium chlorine

fireworks

warm

cold

The ingredients (flour, milk, eggs, etc.) are changed

Explanation:

Why was Niels Bohr’s atomic model superior to all the earlier models?

A.
It proved that the atom was indivisible and therefore the smallest unit of matter.
B.
It showed how the electron could orbit the nucleus without falling into it.
C.
It was the first to show that the atom had no net charge.
D.
It used wave behavior to explain the positions of electrons around the nucleus.

Answers

Answer:

B

Explanation:

The Niels Bohr's atomic model superior to all the earlier models is because it showed how the electron could orbit the nucleus without falling into it

two reason that show sugar is compound

Answers

Answer:

Table sugar, or sucrose, is a compound because it's formed when two or more elements are joined together. Its chemical formula is C12H22O11, and it contains carbon, hydrogen and oxygen. More specifically, each molecule of sugar has 12 carbon atoms, 22 hydrogen atoms and 11 oxygen atoms.

Explanation:

hope this helps

Is burning physical or chemical change?

Answers

Answer:

a chemical change

Explanation:

lighting a match is a chemical change. chemical reactions cause chemical change. in a chemical reaction two or more substances, called the reactants, form different substances called products. hope this helped :)

What does the chemical formula CaCl, show about the compound it represents? It is made up of one element. It is made up of two elements. It is made up of three elements. It is made up of four elements.​

Answers

Answer:

It is made up of two elements.

Explanation:

To answer the question given above,

We shall determine the number of elements present in CaCl₂. This can be obtained as follow:

CaCl₂ contains calcium (Ca) and chlorine gas (Cl₂).

This implies that CaCl₂ contains two different elements.

Now, considering the options given in the question above, CaCl₂ is made up of two elements.

Identify the characteristics of a good recrystallization solvent. Select one or more: Is not an organic liquid with a low boiling point. Dissolves a chemical sample well at high temperatures. Does not dissolve a chemical sample well at high temperatures. Does not dissolve a chemical sample well at low temperatures. Dissolves a chemical sample well at low temperatures.

Answers

Answer:

Dissolves a chemical sample well at high temperatures.

Does not dissolve a chemical sample well at low temperatures.

Explanation:

Recrystallization is a purification technique that involves mixing of an impure solid compound with a hot solvent leading to a saturated solution. As this solution cools, the compound to be purified becomes less soluble in the solvent, and pure crystals appear from the solution as the solution cools.

A good recrystallization solvent should

Not dissolve the compound that we want to purify at room temperature Dissolve the compound completely only  at the solvent's boiling point Dissolve all the soluble impurities in the sample very well at room temperature.Have a fairly low boiling point such that its boiling point is lower than the melting point of the compound to be purified and evaporates easily when air-drying the sample.

Which list of elements contains a metal, a melalloid and a nonmetal

Answers

Answer:

group 15 ( the nitogen group)

Explanation:

HELP ASAP PLS Is an oxygen ion and fluorine ion bigger and why?

Answers

Answer:

From top to bottom of the periodic table ions will increase in radii. However, now left to right the radius is more of a function of the number of electrons. ... Similarly, O2- will be larger than F- as both have 10 electrons but Z=8 for oxygen and Z=9 for fluorine.

The oxygen ion is bigger than the fluorine ion , the reason is explained below

What is an Atomic Structure ?

An atom is composed of electrons , protons and neutrons .

Electrons have negative charge and are grouped in different shells around the nucleus

Protons and neutrons are present in positively charged nucleus

The nucleus has the most mass .The atomic number is the number of protons which is equal to the number of electrons.

Both oxygen atom and fluorine atoms are isoelectronic , they have 10 electrons in the shell , but oxygen has 8 protons while fluorine have 9 protons in the nucleus.

It is believed that as the atomic number increases so the attraction forces of the nuclei increases , making the nucleus smaller and the overall atom smaller

while the oxygen atom on reduction forms oxide anion , which is a dianion and a fluorine atom forms fluoride ion which has a single negative charge and the ion which has more electrons have more electron electron repulsion and the size of the ion is bigger.

Hence the oxygen ion is bigger than the fluorine ion.

To know more about Atomic Structure

https://brainly.com/question/14156701

#SPJ2

What would you use to determine whether an acid or alkali has been added to a solution?
A. Reactant
B. Indicator
C. Adjustor
D. Identifier

Answers

Answer:

B. Indicator

Explanation:

An indicator is used to determine whether an acid or alkali has been added to a solution.

An acid or alkali changes the hydrogen ion concentration in solution. This is indicated by the pH of the solution after which the acid or alkali has been added.

To see this change, indicators are used. An indicator employs color changes to show a change in chemical properties which pertains to the pH. There are several indicators used which are litmus paper, phenolphthalein, methyl orange

A 4.0g Glass was heated from 5°C to 45°C after absorbing 32 J of heat. What is the specific heat of the glass? 

Answers

Answer:

[tex]c=0.2\ J/g^{\circ} C[/tex]

Explanation:

Given that,

Mass of a glass, m = 4 g

Initial temperature, [tex]T_i=5^{\circ} C[/tex]

Final temperature, [tex]T_f=45^{\circ} C[/tex]

Heat absorbed, Q = 32 J

We need to find the specific heat of the glass. The formula for the heat absorbed is given by :

[tex]Q=mc\Delta T\\\\c=\dfrac{Q}{m\Delta T}\\\\c=\dfrac{32\ J}{4\ g\times (45-5)^{\circ} C}\\\\=0.2\ J/g^{\circ} C[/tex]

So, the required specific heat of the glass is [tex]0.2\ J/g^{\circ} C[/tex].

Using the diagram above, answer the following questions:
6. True or False. The arrow labeled C represents a transfer of chemical energy to mechanical energy. Explain why this is true or false. –
7. True or False. The arrow labeled A represents a transfer of solar energy to chemical energy. Explain why this is true or false. –
8. Which arrow or arrows represent a release of carbon dioxide? What process is occurring at the arrow(s) you selected?
9. Which arrow or arrows indicate a process that cycles carbon from living or nonliving organisms? Describe the process or processes you selected.
10. Which arrow or arrows represent reactions that demonstrate a conservation of mass and energy? Explain your answer.


PLEASE HELP!

Answers

Answer:

6. false.  

chemical energy to heat and mechanical. Mechanical that runs the factory in the photo, and Heat energy that rises up in the atmosphere to join the other carbon

molecules in the air. 7. True. The arrow letter A is the transfer of solar power

from the sun, to a chemical reaction to produce food for the plant, which is

called photosynthesis. The leaves in the plant has chlorophyll that absorbs light

energy and transforms it to food.8. The answer would be letter C and F. C because It is

during the burning of the fossil fuels that the carbon dioxide is release into

the atmosphere. When burning the fossil fuels the carbon that was inside the

fossils is released. This also happens with diesel and other forms of natural

gas. While, F is because plant

respiration releases some of the carbon remains of the photosynthesis. While

plants do absorb carbon dioxide, part of their end product also includes reformed

carbon dioxide. Most of the other processes in the phot uses carbon or absorbs

carbon dioxide to aid their sustenance.9. A carbon cycle for living things would be A or B to F

wherein the plants absorb carbon dioxide to aid their production of food, and

then releasing carbon dioxide again as a by product of their food production.

This also happen to aquatic plants.An example of a non-living carbon cycle would be, D or E to

C. This would be the absorption of the carbon on our sea waters or to our soil,

this then gets trapped in there until it is release like through the forms of

fossil fuel burning.10. The law of conservation of mass and energy states that

matter can neither be created nor destroyed, this is very much evident in the

carbon cycle. Because the carbon from the light energy from the sun, or in our

atmosphere, ends up back to our atmosphere just to continue its cycle. The fact

that the carbon cycle is a cycle not just a linear equation proves that energy

can neither be created nor destroyed.

Explanation:

The order is Solumedrol 3 mg/kg for a child weighing 20 kg. Solumedrol is available as 125 mg/2ml. How many ml will be given

Answers

Answer:

0.96mL must be given

Explanation:

First, we need to obtain the mass of Solumedrol required for the child by using its mass. Then, with this mass we can solve the volume that must be administered:

Mass of solumedrol required:

20kg * (3mg / kg) = 60mg of solumedrol are required.

Volume given:

60mg Solumedrol * (2mL / 125mg) =

0.96mL must be given

What are the complete Ionic and Net Ionic equations for the following

a) CaCl2(aq) + Pb(NO3)2(aq) → PbCl2(s) + Ca(NO3)2(aq)

b) CaCl2(aq) + Na2CO3(aq) → CaCO3(s) + 2NaCl2(aq)

c) 2AgNO3 (aq) + BaI2(aq) → Ba(NO3)2 (aq) + 2AgI (s)

Answers

Answer:

Check photo

Explanation:

H3PO4 what’s the name?

Answers

Answer:

Phosphoric acid

Explanation:

Answer:

Phosphoric acid

Explanation:

Phosphoric acid is an oxyacid, which is formed when hydrogen combines with the polyatomic ion phosphate. The polyatomic ion for phosphate is [tex]PO_4^-3[/tex]. To combine this with hydrogen, we "criss-cross" the charges of phosphate (which has a charge of -3) and hydrogen (which has a charge of +1) to get [tex]H_3(PO_4)_1[/tex], the same as [tex]H_3PO_4[/tex].

To answer this question, we essentially reverse these steps. First, we would recognize that this is a hydrogen atom bonded with phosphate. Because phosphate is a polyatomic ion, we know that this is an oxyacid. Because it involves phosphate, we call it phosphoric acid.

I hope this helps!

g What amounts of 45% pure silver and 50% pure silver should be mixed to obtain 14 grams of 46% pure silver

Answers

Answer:

11.2g of the 45% pure silver and 2.8g of the 50% pure silver.

Explanation:

14g of 46% pure silver contains:

14g*46% = 6.44g of silver are required. Thus, we can write:

6.44 = X*50% + Y*45% (1)

Where X is the mass of 50% pure silver and Y the mass of 45% pure silver.

As the mass of the sample must be 14g:

14g = X + Y (2)

Replacing (2) in (1):

6.44 = (14-Y)*50% + Y*45%

6.44 = 7 - 0.5Y + 0.45Y

-0.56 = -0.05Y

Y = 11.2g of the 45% pure silver

And:

14g-11.2g = X

X =

2.8g of the 50% pure silver

The required amount to obtain 14g of 46% pure silver is 2.8g of 50% silver and 11.2g of 45% silver.

To solve this question, we can assume it's a mathematical problem more than a chemistry problem.

let x represent the amount of 45% of pure Ag

let y represent the amount of 50% of pure Ag

But from the question, we only need 14g from both x and y

We can write an equation to represent this

[tex]x+y=14...equation(i)[/tex]

likewise, we can say that

[tex]0.45x+0.50y=14*0.46\\0.45x+0.50y=6.44...equation(ii)[/tex]

Solving both equations simultaneously,

[tex]x+y=14...equation(i)\\0.45x+0.5y=6.44...equation(ii)[/tex]

from equation (i)

[tex]x+y=14\\x=14-y...equation(iii)[/tex]

substitute equation (iii) into equation (ii)

[tex]0.45x+0.5y=6.44\\x=14-y\\0.45(14-y)+0.5y=6.44\\6.3-0.45y+0.5y=6.44\\[/tex]

collect like terms

[tex]-0.45y+0.50y=6.44-6.3\\0.05y=0.14\\y=\frac{0.14}{0.05}\\y=2.8[/tex]

Now we know the value of the 50% Ag which is 2.8g. Let's substitute it's value into equation (i) and solve for x

[tex]x+y=14\\x+2.8=14\\x=14-2.8\\x=11.2g[/tex]

Learn more about definite proportions here

https://brainly.com/question/1496091

HELP ME PLEASE
Over time, which cell will look the smallest?
A student places four identical cells into four different
liquids
Cell

cell W
cell x
cell Y
cell z

W:Saltier than the cell


X:Less salty than the cell


Y:Equally as salty as the cell

Z:Pure water with no salts


Answers

Answer:

This description can be expressed as follows:

Y > W > XY>W>X

And,

W=ZW=Z

From these expressions we are able to find out that the saltiest cell description is Y, while the less salty is X.

Now, salt is well known as a dehydrating agent. In a process called osmosis cells placed in a salty liquid environment lose water, how?

Well, cells have a semipermeable membrane, in which some substances can get inside. Cells also have water inside. If a cell is placed in a quite salty liquid environment, salt will make the water inside the cells to come out, drying the cell and diminishing its size.

So, in this case, according to the expressions above, Cell Y will look the smallest, while cell X will look the biggest.

If we pour pure water in each liquid, the salt concentration will change and each cell will begin to grow bigger, but the saltiest cell will still be smaller than the others with less salt concentration.

Finally, to answer the question: Y cell will look the smallest after this process

I need a answer ASAP

Answers

Answer:

3.2 millions years old

Explanation:

i hope it helps :)

18.0 mL of water contains 6.022 x 1023 water molecules. How many hydrogen atoms are in 1.00 L of water? (Each water molecule, H2O, contains two hydrogen atoms.)

Answers

Solution :

lt is given that in 18 mL of water their are [tex]6.022\times 10^{23}[/tex] water molecules.

We know, that 1 molecule of water contains 2 atoms of hydrogen.

Hydrogen atom in 18 mL water is,

[tex]2\times 6.022\times 10^{23} = 12.044 \times 10^{23}[/tex] .

So, number of hydrogen atoms in 1 L = 1000 mL are :

[tex]N = \dfrac{1000}{18}\times 12.044\times 10^{23}\\\\N = 6.69 \times 10^{25}\ atoms[/tex]

Hence, this is the required solution.

The atomic masses of 35Cl (75.53 percent) and 37Cl 17 17 (24.47 percent) are 34.968 amu and 36.956 amu, re- spectively. Calculate the average atomic mass of chlorine. The percentages in parentheses denote the relative abundances.

Answers

Explanation:

the average atomic mass of chlorine= (34.968 x 0.7553) + ( 36.956 x 0.2447) = 35.4545

Ca % = 100x (5 x 40/502 ) = 39.84 % ( where 502 is molar mass of comp)

P% = 3 x 30.97367 x 100/502 = 18.51 %

O % = (100x13x16)/502 = 41.434

H % = 100-39.84-18.51-41.434 = 0.216 %

% Ca = 100 x40/( 116) = 34.483 %

% Si = 100 x28/116 = 24.14 %

% O = 100-34.483-24.14 = 41.38 %

help please thank you​

Answers

C. F, Br, Cl, At
Explanation: you can see the periodic table

Do earthquakes occur at convergent plate boundaries?
Yes or no?

Answers

Answer:yes

Explanation:

A piece of glass has a temperature of 83˚C. Liquid that has a temperature of 43˚C is poured over the glass, completely covering it, and the temperature at equilibrium is 53˚C. The mass of liquid and glass is the same. If the specific heat of glass is 840 J/(kg˚C), determine the specific heat of the liquid.

Answers

Answer: The specific heat of the liquid is [tex]2520J/kg^0C[/tex]

Explanation:

[tex]heat_{absorbed}=heat_{released}[/tex]

As we know that,  

[tex]Q=m\times c\times \Delta T=m\times c\times (T_{final}-T_{initial})[/tex]

        .................(1)

where,

q = heat absorbed or released

= mass of glass = x kg

= mass of liquid = x kg

= final temperature =

[tex]T_1[/tex] = temperature of glass = [tex]83^oC[/tex]

[tex]T_2[/tex] = temperature of liquid = [tex]43^oC[/tex]

[tex]c_1[/tex] = specific heat of glass = [tex]840J/kg^0C[/tex]

[tex]c_2[/tex] = specific heat of liquid= ?

Now put all the given values in equation (1), we get

[tex]-[(x\times 840\times (53-83)]=x\times c_2\times (53-43)[/tex]

[tex]c_2=2520J/kg^0C[/tex]

Therefore, the specific heat of the liquid is [tex]2520J/kg^0C[/tex]

How can both the pitcher and the glass contain the same volume of iced
tea?

Answers

Answer: $6,600[tex]\alpha \sqrt[n]{x} \lim_{n \to \infty} a_n[/tex]

Explanation:

GIVING OUT BRAINLIEST!!!!!!!!!
Which substance has the lowest specific heat?
O Beach sand
O
Beach water
O Ice
Pool water

Answers


Uhhhh I pretty sure it’s pool water

What would you use to determine whether an acid or alkali has been added to a solution?
A. Reactant
B. Indicator
C. Adjustor
D. Identifier

Answers

Answer:

B. Indicator

Explanation:

An indicator is used to determine whether an acid or alkali has been added to a solution.

Indicators can be liquid or a paper called litmus paper. There also some digital forms of indicators that can tell whether an acid or alkali has been added to a solution.

An acid and alkali will change the pH of a solution. pH is the amount of hydrogen ions that are in a solutionSo, these changes in the pH when an acid or alkali is introduced is usually monitored using indicators. Examples of indicators are litmus paper, methyl orange, methyl red, bromothymoblue

Is the following compound symmetrical going across?

Answers

Answer:

Yes

Explanation:

A molecule has a center of symmetry when, for any atom in the molecule, an identical atom exists diametrically opposite this center an equal distance from it(Wikipedia).

A center of symmetry is said to exist in a molecule when reflection of all parts of the molecule through the center of symmetry produces an indistinguishable configuration(Housecroeft and Sharpe,2012)

Obviously, the Cl2 molecule has a center of symmetry, hence it is symmetrical. Reflection of the molecules through its center of symmetry produces an indistinguishable configuration.

Other Questions
Hey guys can one of you help me pls its only one small question Does (3,4) satisfy the equation-5x + 2y = 23? aA stone 'X' of mass 2 kg is at the height of 2 m from the ground levelAnother similar stone 'Y' of mass 4 kg is at the height of 4 m from the groundlevel. What is the difference between their potential energy?un minutes Calculate The plugin that changes Jenkins to use green balls instead of blue for successful builds is ________. Decide whether the pronunciation is correct or incorrect. Drag and drop the word into the correct column.encourage en-KUR-Correct PronunciationIncorrect Pronunciationexplain ik-SPLAYNjustity JUHS-tun-tahyplayful PRET-tuhmspecial SLISP-uhtheroic hi-ray-IT An architect draws a plan for a wheelchair ramp on the plan, the ramp is 2cm high and 24cm long what might the dimensions of the actual ramp be (use equivalent ratios) slope of 2,11 and 5,2 Hey guys please help!! What is the definition of fourteen points? breakout edu keyla winter wonderland questioni CAN'T DO THIS I've tried so many times how do you do it What became of most of the Central powers colonies after World War I? They became independent nations. They remained colonies of Central Powers nations. They became League of Nations mandates. They were run by the League of Nations. Express 10 : 12 as a decimal.(Round to the nearest hundrerdth) TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Why did debates among civil rights activists increase after 1965? What were the causes and effects of these debates? (Look into SNCC, CORE, Black Power, and the SCLC, Stokeley Carmichael, Huey Newton &/or Bobby Seale) 1 1 The slope of the line below is -1/7. Write a point-slope equation of the lineusing the coordinates of the labeled point. What might be the consequences of your choice? Political: Economic: Social: What are the two ways a subduction zone can be generated? The local lighting company found that 2 out of every 10 lightbulbs was defective. Ifthere are a total of 120 bulbs in a box, how many can they predict will be defective? Quienes intervienen en este caso de violencia? En la fragmento de la novela corazn a shop is having a sale all items are reduced by 30% work out the sale price of an item normally priced at 110