102 - Harder brackets
Find an expression without brackets
for the area of each rectangle.
(x + 3)
area =
12)
No
calc
р
(-9)
Total
area =
121​

102 - Harder BracketsFind An Expression Without Bracketsfor The Area Of Each Rectangle.(x + 3)area =12)Nocalc(-9)Totalarea

Answers

Answer 1

Answer:

For figure 1:

Area of rectangle = 7x + 21

For figure 2:

Area of rectangle = [tex]\mathbf{p^2-9p }[/tex]

Step-by-step explanation:

We need to find area of rectangle

The formula used is: [tex]Area\:of\:rectangle=Length\times Width[/tex]

For figure 1:

Length = 7

Width = x+3

Putting values in formula and finding area of rectangle

[tex]Area\:of\:rectangle=Length\times Width\\Area\:of\:rectangle=7\times (x+3)\\Now,\: multiply\:7\:with\:terms\;inside\:the\:bracket\\Area\:of\:rectangle=7(x)+7(3)\\Area\:of\:rectangle=7x+21\\[/tex]

So, area of rectangle = 7x + 21

For figure 2:

Length = p

Width = p-9

Putting values in formula and finding area of rectangle

[tex]Area\:of\:rectangle=Length\times Width\\Area\:of\:rectangle=p\times (p-9)\\Now,\: multiply\:p\:with\:terms\;inside\:the\:bracket\\Area\:of\:rectangle=p(p)-p(9)\\Area\:of\:rectangle=p^2-9p\\[/tex]

So, area of rectangle = [tex]\mathbf{p^2-9p }[/tex]


Related Questions

A computer company can inspect 12 laptops in 8 hours. what's the ratio

Answers

Answer:

4:1

Step-by-step explanation:

hope this helps

Answer:

The ratio is 1 hour to 1.5 laptops

Step-by-step explanation:

If you divide the time by amount done, there you have the answer.

There are 8 bones in a large snake for 3 bones in a small snake. The small snake has 150 bones. How many bones does the large snake have?

Answers

Answer:

400!

Step-by-step explanation:

150/3= 50

50*8=400

Answer:

XD lol

Step-by-step explanation:

The following graph shows a proportional relationship.What is the constant of proportionality between y and x in the graph?

Constant Of Proportionality = ________

Answers

Constant of proportionality is 0.20 because constant of proportionality is k=y/x so 1/5=0.20 or 0.2

Answer:

Step-by-step explanation:

y=kx

(5,1)

1=k*5

1/5=k*5/5

1/5=k

The constant of proportionality between y and x in this graph is  

1/5

anyone know the answer to this? :))))

Answers

Hello!

[tex]\large\boxed{x = 17}[/tex]

[tex]\sqrt{x -1} + 5 = 9[/tex]

Begin by subtracting 5 from both sides:

[tex]\sqrt{x -1} = 9 - 5\\\\\sqrt{x -1} = 4[/tex]

Square both sides to get rid of the radical:

[tex]x - 1 = 16[/tex]

Add 1 to both sides to completely isolate for x:

[tex]x = 17[/tex]

math The newly elected president needs to decide the remaining 3 spots available in the cabinet he/she is appointing. If there are 15 eligible candidates for these positions (where rank matters), how many different ways can the members of the cabinet be appointed

Answers

Answer:

2730 ways

Step-by-step explanation:

Given that,

There are 15 eligible candidates for these positions.

The newly elected president needs to decide the remaining 3 spots available in the cabinet he/she is appointing.

It is a concept based on permutations.

[tex]P(n,r)=\dfrac{n!}{(n-r)!}[/tex]

Put n = 15 and r = 3

[tex]P(15,3)=\dfrac{15!}{(15-3)!}\\\\=\dfrac{15!}{12!}\\\\=\dfrac{15\times 14\times 13\times 12!}{12!}\\\\=15\times 14\times 13\\\\=2730[/tex]

Hence, 2730 ways can the members of the cabinet be appointed

9 square root 3 divided by 3 square root 3

Answers

Answer:

[tex] \frac{9 \sqrt{3} }{3 \sqrt{3} } = \frac{9}{3} = 3 \\ [/tex]

3 is the right answer.

Plz help lol
(12221×222) ×+212%234\/()231331783)2343#23=22+×233)1(23€£÷÷) =​

Answers

Answer:

(c) 24 (d) 2 -4 (e) 22 2 1.25 0

Step-by-step explanation:

Problem 1.1 (10 Points) Let 21 2j, and 23 j. Find the value of each of the following 3 4j, 22 expressions and give your answers in rectangular form z t jy. (a) 132122 (b) 321 421 (c) (21)3 (Note that superscript denotes conjugation.) 222 21 (d) 22 (e) 2223 Problem 1.2 (10 Points) (a) Find real numbers r and y such that 5z -3y j(5y z) 4. (b) Show that any complex number z can also be expressed as z e 2"* k 0, 1,2, 3. Problem 1.3 (10 Points) Express each of the following complex numbers in polar form. a) 2 2V3 (c) 1 j j2 7 4j (d) 3-2j (e) Problem 1.4 (10 Points) Use the results from Problem 1.2 (b) above to find all roots of the following complex numbers and plot your results in the complex plane. (a) 1 (Hint: there are 5 different answers and one is 2 (b) 23 (1 -j) (Hint: there are 3 different answers. (c) 24 (d) 2 -4 (e) 22 2 1.25 0

PLEASE ANSWER ASAP FOR BRANLEST!!!!!!!!!!!!!!!
Solve the equation
7 = -10s - 3
what is s?

Answers

Answer:

s=-1

Step-by-step explanation:

10=-10s

-1=s

Answer: s = -1

Step-by-step explanation:

7 = -10s - 3 Add three to both sides

10 = -10s. Divide -10 by 10

s = -1

When a respondent indicates that he is 25 years old when he is actually 35 years old, he is contributing to:


nonresponse error.


response error.


sampling error.


nonsampling error.

Answers

Answer:

Response Error

Step-by-step explanation:

A jar contains 12 caramels, 7 mints and 16 dark chocolates. The probability of selecting a dark chocolate, eating it, and then a selecting a caramel is the setup. What is the probability fraction of "selecting a dark chocolate".

Answers

Answer:

45.7%

Step-by-step explanation:

12 + 7 + 16 = 35

16/35 = 0.457 = 45.7%

Question???
-9 - (-4) =

Answers

Answer:

-5

Step-by-step explanation:

Answer:

-5

Please mark as brainliest if this helped you the most, thanks if you do and have a good day/night!

Triangle ABC ~ Triangle DEF, which of the following is a conclusion that can be drawn?
A. AB/AC=DE/DF
B. AB/DE=CA/DE
C. BC/AB=DE/EF
D. BC/AC=EF/DE​

Answers

9x^2-10x^1+1 from −2x^2+4x−10.
your answer is A.) AB/AC=DE/DF

Which has the least value for 9? *


A. 1.95

B. 0.1039

C. 3.092

D. 2.009​

Answers

Answer:

0.1039

Step-by-step explanation:

Obtain the place value of 9 in each value and choose the smallest :

1.95

9 is the first digit after the decimal point ; which is equal to 0.9 = tenth place

0.1039

9 is the 4th digit after the decimal point ; which is equal to 0.0009 = ten thousandth place

3.092

9 is the second digit after the decimal point ; which is equal to 0.09 = hundredth place

2.009​

9 is the third digit after the decimal point ; which is equal to 0.009 = thousandth place

Hence the smallest value of 9 among the options given resides in 0.1039 (ten thousandth place).

Which graph represents a linear function?

Answers

Answer:

Graph two would be the answer because it is not curving.

Step-by-step explanation:

find the rate of travel for a fishing boat with a speed of 10 miles per hour moving Downstream with a current of 5 miles per hour ​

Answers

Answer:

36 miles (b+C) (3)of rate

Pls help! This is due in 5 minutes!

Answers

Answer:

The Base is 150 and the Exponent is 4

Which linear equation is represented by the table?

x −2 1 3 6
y 7 4 2 −1

Answers

Answer:

help calll me daddy

Step-by-step explanation:

Two bags of cereal are packed in a box. The total weight of the box and the two bags of cereal is 50.00 ounces. One bag of cereal weighs 16.03 ounces, the other weighs 18.98 ounces. How much does the box weigh?
14.99 ounces
14.72 ounces
14.08 ounces
14.01 ounces

Answers

14.99 is the correct answer

a) This problem involves 8-digit binary strings such as 10011011 or

00001010.

i How many such strings are there?

ii. How many such strings end in 0?

iii. How many such strings have l's for their second and fourth digits?

iv. How many such strings have l's for their second or fourth digits?

b) Find how many 9-digit numbers can be made from the digits 1, 2, 3, 4, 5, 6,

7, 8, 9 if repetition is not allowed and all the odd digits occur first (on the

left) followed by all the even digits.

c) How many permutations of the letters A, B, C, D, E, F, G are there in which

the three letters ABC appear consecutively, in alphabetical order?

Answers

Answer:

a)

i) With an eight digit binary number, there are 2⁸, or 256 possible combinations.

ii) Each digit is set to 1 or 0 for exactly half of all combinations.  This means that half of all strings, or 256 / 2 = 128 strings end with a zero.

iii) 3/4, or 128 + 64 = 192 of the combinations have a 1 for either the second or fourth digit.  If you consider:

Half of all digits will have the second bit set to 1

Half of all digits will have the fourth bit set to 1

Half of those will overlap

Then that's half the digits, plus half the digits, minus half of half the digits. 1/2 + 1/2 - 1/4 = 3/4

iv) This is a duplicate of iii, so again, 192

b) If we're allowed to repeat the usage of the digits, then answer would be the number of values available to the power of the number of digits used.  We're allowed six distinct digits, so the total combination of 9 digit numbers would be 6⁹, or 10077696

c) In this case we can look at it simply as permutations of the set {"ABC", "D", "E", "F"}, which gives us 4! which equals 24

The scatter graph shows the scores of 16 students on the biology and physics tests

Answers

Step-by-step explanation:

85 l don't see questions properly so l knew this much only l don't know exact answer so l write this answer

Determine if the ordered pairs represent a function.
•Yes
•No

{(1,3), (4, 12), (5, 15), (6, 18)}

Answers

The answer is yes !!!!!!!!!!!!!!!!!!!!!

PLEASE NEED HELP ASAP TYTY I WILL BE GIVING THANKS!

Answers

Answer:

B. 112°

Step-by-step explanation:

4x -4 = (3x+4) + (2x-44)

4x -4 = 5x - 40

5x - 4x = -4 + 40

x = 36

∠BCA = 3 * 36 + 4 = 112

What is 4 8/9 plus 3 2/11

Answers

Answer:

8 7/99, Decimal. (8.07 repeated)

Step-by-step explanation:

Sorry it’s so blurry but I think u can see it it’s 8.07..... also if u needed to know it’s irrational.

When you add 98 to a number you usually...

Answers

Aneser:

+98

Step-by-step explanation:

when you are adding something to something to something else u put a plus sign to add it hope this helps

Simplify c x d x 4 =

Answers

Answer:

Ya the person above me is right 4cd

What is the rectangular form of z = 6(cos((3pi)/4) + i sin((3pi)/4))

Answers

Answer:

Z= -3 square root 2 + 3i square root 2

Step-by-step explanation:

Answer:

C :)

Step-by-step explanation:

got it right on edge, hope it helps

6/n = 9/24 n=?
I need help, please show steps.....

Answers

Answer:

n=16

Step-by-step explanation:

6n=9246n=924 nn

Write the problem as a mathematical expression.

6n=9246n=924 nn

Cancel the common factor of 99 and 2424.

Factor 33 out of 99.

6n=3(3)246n=3(3)24

Cancel the common

Factor 33 out of 2424.

6n=3⋅33⋅86n=3⋅33⋅8

Cancel the common factor.

6n=3⋅33⋅86n=3⋅33⋅8

Rewrite the expression.

6n=386n=38

Multiply the numerator of the first fraction by the denominator of the second fraction. Set this equal to the product of the denominator of the first fraction and the numerator of the second fraction.

6⋅8=n⋅36⋅8=n⋅3

Solve the equation for nn.

Rewrite the equation as n⋅3=6⋅8n⋅3=6⋅8.

n⋅3=6⋅8n⋅3=6⋅8

Multiply 66 by 88.

n⋅3=48n⋅3=48

Divide each term by 33 and simplify.

Divide each term in n⋅3=48n⋅3=48 by 33.

n⋅33=483n⋅33=483

Cancel the common factor of 33.

Cancel the common factor.

n⋅33=48

Please help
x2 + 14x + 37 = 0

Answers

Answer:

x = −37/16

This is the value of x which completes the equation properly, unless you mean x^2 instead of x2.

The circle graph shows the preferences of town residents for the new playground equipment in a park

If 240 residents responded to the survey, how many residents preferred each type of playground equipment


Swings:

residents

Sandbox: residents



Obstacle course: residents

Answers

Answer:

swings: 120 (50%)

obstacle course: 80 (1/3)

sandbox: 40

Step-by-step explanation:

we know by looking, that swings makes up 50%, so we divide 240 by 2 to get 120

the obstacle course makes up one-third, 1/3 of 240 is 80

add 120+80 to get 200

to find the sandbox amount, do 240 minus 200 and we get 40

The circle graph is used to show how variables measure against one another using a circle of different sectors.

There are 40 residents in sandbox, 80 in obstacle course, and 120 in the swings

The number of residents is given as:

[tex]n = 240[/tex]

From the given circle graph, we have the following proportions

[tex]Sandbox = 1/6n[/tex]

[tex]Obstacle = 1/3n[/tex]

[tex]Swings= 1/2n[/tex]

So, the number of residents in each equipment is:

[tex]Sandbox = \frac 16 \times 240[/tex]

[tex]Sandbox = 40[/tex]

[tex]Obstacle = \frac 13 \times 240[/tex]

[tex]Obstacle = 80[/tex]

[tex]Swings =\frac 12 \times 240[/tex]

[tex]Swings =120[/tex]

Hence, there are 40 residents in sandbox, 80 in obstacle course, and 120 in the swings

Read more about circle graphs at:

https://brainly.com/question/796269

Find the perimeter of this quarter circle with radius

Find the perimeter of a quarter circle with radius, r = 80mm.
Give your answer as an expression in terms of π.

Answers

Answer:Perimeter of a quarter circle with radius

To find the perimeter of the quarter circle, find the circumference of the whole circle, divide by 4, and then add the radius twice. To find the radius when you are given the area of the quarter circle, multiply the given area by 4, then plug this number in for A into the formula A = pi * r^2 and then solve for r.

I HOPE THIS HELPS

Other Questions
Leah spent three times the amount Damean spent on CDs. Damean spent $33.87. How much did Leah spend on CDs? Many Nubian artifacts were found in tombs of Egyptian pharaohs.Please select the best answer from the choices providedOF 6 is 16% of what number? Choose one of the three themes (social oppression, greed, or good vs. Evil) and explain something you know about it in the real world OR explain where else you have seen the theme (a book, movie, show, etc.) Please help quick Write the inverse of each function. a. f(x)=x103b. g(x)=3/4x+6Please help me I beg you!!!! 25 points!!!! I need to pass!!! A 12,000-gallon pool is being filled at a rate of 40 gallons per minute. At this rate, how many minutes will it take to fill the pool 3/4 full? Abdul bought a loaf of bread for $1.59 and a package of cheese for $2.69. How much did Abdul spend? Explain the role that Benjamin Franklin played during the American Revolution.. After the government ordered the removal of all American Indians from Illinois, a. Black Hawk attacked a militia led by Isaiah Stillman. b. the Sauk fought until they ran out of supplies. c. Black Hawks followers killed three delegates of a peace convention sent under a white flag to Saukenuk. d. Sauk forces attacked U.S. troops as they attempted to retreat across a river. Read this excerpt from the Supreme Court's Hazelwood v. Kuhlmeier dissenting opinion: The state educator's undeniable, and undeniably vital, mandate to [teach] moral and political values is not a general warrant to act as "thought police" stifling discussion of all but state-approved topics. . . . Official censorship of student speech on the ground that it addresses "potentially sensitive topics" is . . . impermissible.4 The reasoning in this opinion is most similar to the reasoning in which other Supreme Court ruling? A. New Jersey v. T.L.O. B. Miranda v. Arizona C. Gideon v. Wainwright D. Tinker v. Des Moines pls help asap!! no trolls 1. Many plants can reproduce asexually. How is this an advantage for the plant? Why can it sometimes be a disadvantagefor the plant? Use details to support your answer. PLS ANSWER ASAP. ILL GIVE BRAINLIEST! Match the system for each of the following bodily organs.1.Nose a. Skeletal System2.Skull b. Circulatory System3.Kidneys c. Urinary System4.Veins d. Respiratory System 2 Which piece of evidence explains WHY the five themes of geography were created (A) In 1984. educators sought to better organize the teaching of geography in kindergarten through 12th grade classrooms. (B) The themes were created by the National Council for Geographic Education and the Association of American Geographers. (C) While these five themes have been since replaced by the National Geography Standards, they still provide an effective organization for the teaching of geography (D) Humans shape the landscape through their interaction with the land; this has both positive and negative effects on the environment Fill in the blank with the appropriate preposition.Paris est _____________ New York.a.) prs deb.) loin dec.) surd.) dans plz help timed MATHHHH 12 pointes Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) Select one of the readings in this unit, EXCEPT the Gettysburg Address, and in at least 150 words, discuss the historical context or cultural context the author demonstrates. i cant ever forgive the vampire diaries producers and directors for killing enzo but letting ratty matty the human LIVE?? like why did they keep matt alive when no one liked him but KILLED ENZOOOOOO How did Tisquantum help the Pilgrims????i will give brainliest and extra points