10-
Next O
Post Test: Linear Equations
10
Select all the correct answers
Which lines in the graph have a slope greater than 1 but less than 27
line 1
line 2
line 3
line 4
line 5
3 4
5

10-Next OPost Test: Linear Equations10Select All The Correct AnswersWhich Lines In The Graph Have A Slope

Answers

Answer 1

The slope of the straight line in the graph that expresses proportional relationship indicates that the lines in the graph that have a slope greater  than 1 but less than 2 are;

Line 3Line 4

What is the slope of a graph of a straight line?

The slope of the graph of a straight line is the ratio of the rise to the run on the line.

The slope of a graph with a slope of 1 has an increase in the y-value of 1 for each increase in the x-value of 1

Slope = 1 = Δy/Δx

When the slope is greater than 1, we get;

Δy/Δx > 1, therefore Δy is larger than 1 when Δx is 1.

Similarly, the slope of a graph with a slope of 2 has an increase in the y-value of 2 for each increase in the x-value of 1

Slope = 2 = Δy/Δx

When the slope is less than 1, we get;

Δy/Δx < 2, therefore Δy is less than 2 when Δx is

The lines in the graph that have a slope greater than 1 but less than 2 are therefore the graphs with the coordinates;

Line 3; (0, 0), (4, 6); Slope = 6/4 = 3/2, therefore; 1 < slope = 3/2 < 2

Line 4; (0, 0), (5, 6); Slope = 6/5, therefore; 1 < Slope < 2

The line 5 has a slope of 1, and the line 1, has a slope of 3, line 2 has a slope of 2

The correct options are line 3 and line 4

Learn more on the slope of a straight line equation here: https://brainly.com/question/31182083

#SPJ1


Related Questions

The population of a city after t years is given by P(t)=36,442e0.042t,
where t=0
corresponds to the current year.
How many years from the current year will it take for the population of the city to reach 75,000
?
Round to the nearest hundredth of a year.

Answers

Answer:

[tex]36442 {e}^{.042t} = 75000[/tex]

[tex]t = 17.18 \: years[/tex]

PLEASE HELP ME ANSWER THIS QUESTION I NEED IT PLEASE.
Find ∫ x^5 √(2 - x^3) dx

Answers

Answer:

[tex]\displaystyle \frac{2}{15}(2-x^3)^{\frac{5}{2}}-\frac{4}{9}(2-x^3)^{\frac{3}{2}}+C[/tex]

Step-by-step explanation:

[tex]\displaystyle \int x^5\sqrt{2-x^3}\,dx\\\\=\int x^5(2-x^3)^{\frac{1}{2}}\,dx\\\\=\int x^3x^2(2-x^3)^{\frac{1}{2}}\,dx[/tex] <-- Breaking up [tex]x^5[/tex] into [tex]x^3x^2[/tex] helps us later

Let [tex]u=2-x^3[/tex] and [tex]du=-3x^2\,dx[/tex] so that [tex]2-u=x^3[/tex] and [tex]\displaystyle -\frac{1}{3}du=x^2dx[/tex]:

[tex]\displaystyle -\frac{1}{3} \int (2-u)u^{\frac{1}{2}}\,du\\\\=-\frac{1}{3} \int 2u^{\frac{1}{2}}-u^{\frac{3}{2}}\,du\\\\=-\frac{1}{3}\biggr(\frac{4}{3}u^{\frac{3}{2}}-\frac{2}{5}u^{\frac{5}{2}}\biggr)+C\\\\=-\frac{1}{3}\biggr(\frac{4}{3}(2-x^3)^{\frac{3}{2}}-\frac{2}{5}(2-x^3)^{\frac{5}{2}}\biggr)+C\\\\=-\frac{4}{9}(2-x^3)^{\frac{3}{2}}+\frac{2}{15}(2-x^3)^{\frac{5}{2}}+C\\\\=\frac{2}{15}(2-x^3)^{\frac{5}{2}}-\frac{4}{9}(2-x^3)^{\frac{3}{2}}+C[/tex]

PLEASE SOLVE. I MARK YOU BRaINALIST

Answers

The force of gravity on the rocket is 30 N/kg, the mass of the rocket stays constant while its weight varies

What is force of gravity?

The force of gravity is the force exerted on an object by the earth or a planet.

Given that the force of gravity on an object when it is launched is 30 N/kg. This is three times larger than Earth's gravity. To determine what happens to the mass and weight of the object when gravity is 30 N/kg, we proceed as follows.

We know that weight, W = mg where

m = mass of object and g = gravity

Since gravity g = 30 N/kg, we have that

W = mg

= m × 30 N/kg

= 30m

Now, we know that mass is an intrinsic property and weight is an extrinsic property. This means that the mass of the object is constant but its weight can change based on the object's position and depends on the amount of mass.

So, since the force of gravity on the rocket is 30 N/kg, the mass of the rocket stays constant while its weight varies

Learn more about force of gravity here:

https://brainly.com/question/27943482

#SPJ1

If u⃗ =⟨3,9⟩ and w⃗ =⟨−3,1⟩, find 13u⃗ −2w⃗ .

Answers

The resultant vector of the operation 13u - 2w is given as follows:

13u - 2w = <45, 115>.

How to obtain the resultant vector?

The vectors in the context of this problem are defined as follows:

u = <3,9>.w = <-3,1>.

When we multiply a vector by a constant, each component of the vector is multiplied by the constant, hence:

13u = <39, 117>.2w = <-6, 2>.

Then when the two vectors are subtracted, the equivalent components of each vector are subtracted, hence:

13u - 2w = <39, 117> - <-6, 2>

13u - 2w = <45, 115>.

More can be learned about vectors at https://brainly.com/question/25705666

#SPJ1

Ms. Chung drives the same distance to go to work every Monday through Friday. On Saturday she drove g the distance she drives to work. The distance she drove on Saturday was 0.9 miles. Part A: In the first box, enter an equation to represent the distance, d, that Ms. Chung drives to work. Part B: In the second box, enter the distance Ms. Chung drives to work.

Answers

A) The algebraic expression will be 12d + 7 = 91

B) He drives 7 miles per day to work.

For 11 days straight, Ms. Chung drove the same distance every day going to and coming from work.

The distance she drove on Saturday was; 0.9 miles.

The number of miles she drives per day:

84 miles/12

= 7 miles per day

Let the number of miles she travels be day = d

12d + 7 = 91 miles

12d + 7 = 91

12d = 91 - 7

12d = 84

d = 84/12

d = 7 miles per day

Learn more about equations here;

https://brainly.com/question/25180086

#SPJ1

Find the volume of a pyramid with a square base, where the side length of the base is
14.4
m
14.4 m and the height of the pyramid is
15.3
m
15.3 m. Round your answer to the nearest tenth of a cubic meter.

Answers

The volume of a pyramid with a square base is 3172.608 cubic meter.

Given that, the side length of the base is 14.4 m and the height of the pyramid is 15.3 m.

Formula to find the volume of the object is Volume = Area of a base × Height.

Here, volume = 14.4²×15.3

= 3172.608 cubic meter

Therefore, the volume of a pyramid with a square base is 3172.608 cubic meter.

To learn more about the volume visit:

https://brainly.com/question/13338592.

#SPJ1

Consider the equation below. (If an answer does not exist, enter DNE.)
f(x) = x3 − 3x2 − 9x + 3

Answers

The interval on which f(x) is increasing is (-∞, -1) and (3, ∞).

To find the interval on which the function f(x) = x³ - x² - 9x + 3 is increasing, we need to determine where the derivative of the function is positive.

First, let's find the derivative of f(x):

f'(x) = 3x² - 6x - 9

3x² - 6x - 9 = 0

3(x - 3)(x + 1) = 0

x - 3 = 0 or x + 1 = 0

x = 3 or x = -1

These are the critical points of the function.

Let's test a value from each interval:

For x < -1, let's use x = -2:

f'(-2) = 3(-2)² - 6(-2) - 9 = 12 + 12 - 9 = 15 > 0

For -1 < x < 3, let's use x = 0:

f'(0) = 3(0)² - 6(0) - 9 = -9 < 0

For x > 3, let's use x = 4:

f'(4) = 3(4)² - 6(4) - 9 = 12 - 24 - 9 = -21 < 0

From these test values, we can see that f(x) is increasing on the interval (-∞, -1) and (3, ∞).

Therefore, the interval on which f(x) is increasing is (-∞, -1) and (3, ∞).

Learn more about Increasing Function here:

https://brainly.com/question/12924332

#SPJ1

A home decor store donated a percent of every sale to hospitals. The total sales were ​$8,400 so the store donated ​$672. What percent of ​$8,400 was donated to ​hospitals?

Answers

Answer:

8% of sales donated

-----------------------

What percent of $8400 is $672?

672/8400 * 100% = 0.08 * 100% = 8%

Answer:

8%

Step-by-step explanation:

To find the percentage that was donated to hospitals, we can set up the following equation:

[tex]\sf \dfrac{total\: donation}{ total \:sales} * 100 = percentage \:donated[/tex]

In this case, the total donation was $672 and the total sales were $8,400.

Substituting these values into the equation, we get:

[tex]\sf \dfrac{672}{8400} * 100 = percentage \:donated[/tex]

Simplifying this expression:

(0.08) * 100 = percentage donated

8% = percentage donated

Therefore, the home decor store donated 8% of $8,400 to hospitals.

Find the number that belongs
in the green box.
37⁰
64°
21.1
30
Round your answer to the nearest tenth.

Answers

The length of the third side, which is opposite the angle of 84°, is approximately 30.1 units.

Given is a triangle with angles 64° and 32°, and side 21.1 and 30, we need to find the third side,

So, according to the angle sum property of triangle,

Third angle = 180° - (64° + 32°)

Third angle = 84°

To find the length of the third side, which is opposite the angle of 84°, we can use the Law of Sines.

The Law of Sines states that the ratio of the length of a side to the sine of its opposite angle is constant for all sides of a triangle.

Let's label the triangle with angles A, B, and C, and sides a, b, and c, respectively.

In this case, angle A is 84°, angle B is 64°, and angle C is 32°. Side a is the side opposite angle A, side b is the side opposite angle B, and side c is the side opposite angle C.

Using the Law of Sines, we have the following equation:

sin(A) / a = sin(B) / b = sin(C) / c

We want to find the length of side a, so we can rearrange the equation as follows:

sin(A) / a = sin(B) / b

Now we can substitute the given values:

sin(84°) / a = sin(64°) / 30

To find side a, we can solve for it algebraically:

a = (sin(84°) × 30) / sin(64°)

Calculating this expression, we get:

a ≈ 30.1

Therefore, the length of the third side, which is opposite the angle of 84°, is approximately 30.1 units.

Learn more about Law of Sines click;

https://brainly.com/question/13098194

#SPJ1

Here are the first five terms of a number sequence. 23 20 17 14 11 (a) Write down the 8th term of this sequence. *********​

Answers

The 8th term of the sequence is 2.

To find the 8th term of the given number sequence, we can observe that the sequence is decreasing by 3 with each term.

Starting from the first term, which is 23, we subtract 3 repeatedly to get the subsequent terms:

23 - 3 = 20

20 - 3 = 17

17 - 3 = 14

14 - 3 = 11

We can see that each term is obtained by subtracting 3 from the previous term.

To find the 8th term, we continue this pattern:

11 - 3 = 8

8 - 3 = 5

5 - 3 = 2

Therefore, the 8th term of the sequence is 2.

for such more question on sequence

https://brainly.com/question/27555792

#SPJ8

PLEASE HELP QUICK!! WILL MARK BRAILIEST!!
Question the formula (equation) for finding the VOLUME of a rectangular prism is?
A= 1/2 bh

A= lw

V= lwh

V= x + 3

Answers

Answer:

V = lwh

Step-by-step explanation:

The volume of a rectangular prism or a rectangle stretched is the basic rectangle area formula ( wh ) multiplied by the new factor, the length ( l ). This makes the formula V = lwh
Hope this helped

Find a dimensionless product relating the torque, (ML²T-²) produced by an automobile engine, the engine's rotation rate, (T-¹), the volume V of air displaced by the engine, and the air density p.​

Answers

The dimensionless product relating the torque, rotation rate, volume, and air density is:

Pi = (torque) * (rotation rate)² * (volume)^(1/3)

To find a dimensionless product relating the torque (ML²T⁻²) produced by an automobile engine, the engine's rotation rate (T⁻¹), the volume V of air displaced by the engine, and the air density p, we can make use of the Buckingham Pi theorem.

The Buckingham Pi theorem states that in a physical problem involving n variables with k fundamental dimensions, there will be n - k dimensionless quantities that can be formed as products of powers of the original variables.

In this case, we have 4 variables with 3 fundamental dimensions: torque (M L² T⁻²), rotation rate (T⁻¹), volume (L³), and air density (M L⁻³). Therefore, we expect to have 4 - 3 = 1 dimensionless product.

Let's define the dimensionless product (Pi) as:

Pi = (torque)ᵃ * (rotation rate)ᵇ * (volume)ᶜ * (air density)ᵈ

To determine the powers (a, b, c, d), we equate the dimensions on both sides of the equation:

M L² T⁻² = (M)ᵃ * (T⁻¹)ᵇ * (L³)ᶜ * (M L⁻³)ᵈ

Equating the dimensions of mass (M):

1 = a + d

Equating the dimensions of length (L):

2 = 3c - 3d

Equating the dimensions of time (T):

-2 = -b

Solving these equations, we find:

a = 1

b = 2

c = 1/3

d = 0

This dimensionless product captures the relationship between these variables, independent of their specific units and scaling factors.

for more such questions on air density

https://brainly.com/question/30760200

#SPJ8

What is one over two to the fifth power?

Answers

Answer:0.03125

Step-by-step explanation:

GOO*OOGLE

Step-by-step explanation:

(1/2)^5   = 1/2 * 1/2 * 1/2 * 1/2 * 1/2 =   1/32

The stemplot shows the snowfall, in inches, in US cities during December.

Use this graphic to answer the question.

Use the drop-down menus to complete the statements about the snowfall amounts shown in the stemplot.

This distribution of snowfall amounts is
. There appears to be one outlier in snowfall amount at
inches.

Answers

This distribution of snowfall amounts is skewed to the right

When are data skewed to the right

Data is said to be skewed to the right or positively skewed, when the tail of the distribution extends more towards the right side of the data. This means that there are a few larger values or outliers that pull the mean or median towards the higher end of the scale, resulting in a longer tail on the right side of the distribution.

In a positively skewed distribution majority of the data is concentrated towards the lower values.

Considering the stemplot the majority of the data is in the lower values

Learn more about skewed to the right at

https://brainly.com/question/30459618

#SPJ1

Answer:

to the second part

18.7 inches

21. (1 point) Let y 00 −64y = 0. Find all values of r such that y = kerx satisfies the differential equation. If there is more than one correct answer, enter your answers as a comma separated list. r = help (numbers) Answer(s) submitted:

Answers

The values of r for which y = e^(rx) satisfies the differential equation y″ - 64y = 0 are r = 8 and r = -8.

How to calculate the value

First, differentiate y twice:

y' = [tex]re^{rx}[/tex]

y'' = r²[tex]e^{rx}[/tex]

y'' - 64y = r²[tex]e^{rx}[/tex] - 64[tex]e^{rx}[/tex] = 0

[tex]e^{rx}[/tex] * ([tex]r^{2}[/tex] - 64) = 0

[tex]r^{2}[/tex] - 64 = 0:

Solving this quadratic equation gives:

[tex]r^{2}[/tex] = 64

r = ±8

Therefore, the values of r that satisfy the differential equation are r = 8 and r = -8.

Learn more about equations in

https://brainly.com/question/2972832

#SPJ1

Let y″−64y=0.

Find all values of r such that y=kerx satisfies the differential equation. If there is more than one correct answer, enter your answers as a comma separated list.

Consider polygon ABCD, shown below.
B
C
E
A
G
F
D
Select all the ways that describe rigid transformations that take AEFD to CFEB.

Answers

The option that describes the rigid transformation that take AEFD to CFEB are:

Rotate AEFD 180 degrees counterclockwise around point GRotate AEFD 180 degrees clockwise around point G.

What does it mean to rotate shape 180°?

To rotate a form 180°, turn it about its center point such that it faces the opposite way. This is accomplished by tracing the form on a sheet of paper and then folding it in half so that the two sides of the shape line up. The form is now rotated 180 degrees.

A rigid transformation (also known as a Euclidean transformation or Euclidean isometry) in mathematics is a geometric transformation of a Euclidean space that retains the Euclidean distance between each pair of points.

Learn more about transformation:
https://brainly.com/question/4289712
#SPJ1

Full Question:

Although part of your question is missing, you might be referring to this full question:

See attached image.

9. Jack recorded the number of different colored marbles he has in a pouch. The results are provided in the table below. Color blue 5 brown 4 green. 3 orange 5 red 4 yellow 4 Part B. Jack has another jar of 275 marbles that have the same distribution as the table above. Based on the information in the table, determine the number of yellow marbles​

Answers

Based on the information provided in the table, Jack has 4h yellow marbles.

To determine the number of yellow marbles in the jar of 275 marbles, we can use the information from the table to find the proportion of yellow marbles in the first pouch.

According to the table, there are 4 yellow marbles out of a total of 25 marbles in the first pouch.

Therefore, the proportion of yellow marbles in the first pouch is 4/25.

To find the number of yellow marbles in the jar of 275 marbles, we can multiply this proportion by the total number of marbles in the jar.

Number of yellow marbles = (4/25) x 275 = 44

Therefore, there are 44 yellow marbles in the jar of 275 marbles.

Learn more about probability here:

https://brainly.com/question/30034780

#SPJ1

Which shows a true comparison? Select all that apply.
A. 32.03 > 32.3
B. 3.114 > 3.112
C. 4.003 < 3.996
D. 0.541 > 0.145
E. 0.141 < 0.19

Answers

The true comparisons are:

B. 3.114 > 3.112: In this case, the number 3.114 is greater than 3.112, as the digit in the thousandth place (4) is greater than the corresponding digit in 3.112 (1).

D. 0.541 > 0.145: Here, the number 0.541 is greater than 0.145 because the digit in the hundredth place (4) is greater than the corresponding digit in 0.145 (1).

E. 0.141 < 0.19: In this example, the number 0.141 is indeed less than 0.19, as the digit in the hundredth place (1) is less than the corresponding digit in 0.19 (9).

Option A is not a true comparison because 32.03 is actually less than 32.3. The digit in the hundredth place is 0 in both numbers, and the digit in the thousandth place is 3 in 32.03, while it is 0 in 32.3.

Option C is also not a true comparison since 4.003 is greater than 3.996. The digit in the thousandth place (4) is greater than the corresponding digit in 3.996 (3).

Answer: -D) 0.541 > 0.145

-B) 3.114 > 3.112

-E) 0.141 < 0.19

explanation: The number 3.114 is greater than 3.112, as the digit in the thousandth place (4) is greater than the corresponding digit in 3.112 (1). Here, the number 0.541 is greater than 0.145 because the digit in the hundredth place (4) is greater than the corresponding digit in 0.145 (1). In this example, the number 0.141 is indeed less than 0.19, as the digit in the hundredth place (1) is less than the corresponding digit in 0.19 (9).

Find the equation of the line.
Use exact numbers

Answers

Answer:

y = [tex]\frac{2}{3}[/tex] x + 4

Step-by-step explanation:

the equation of a line in slope- intercept form is

y = mx + c ( m is the slope and c the y- intercept )

calculate m using the slope formula

m = [tex]\frac{y_{2}-y_{1} }{x_{2}-x_{1} }[/tex]

with (x₁, y₁ ) = (- 6, 0) and (x₂, y₂ ) = (0, 4) ← 2 points on the line

m = [tex]\frac{4-0}{0-(-6)}[/tex] = [tex]\frac{4}{0+6}[/tex] = [tex]\frac{4}{6}[/tex] = [tex]\frac{2}{3}[/tex]

the line crosses the y- axis at (0, 4 ) ⇒ c = 4

y = [tex]\frac{2}{3}[/tex] x + 4 ← equation of line

15. The volumes of two similar solids are 857.5 mm^3 and 540 mm^3. The surface area of the smaller solid is 108 mm^2. What is the surface area of the larger solid?

Answers

The surface area of the larger solid is approximately 172 mm sq. approx

Given

The volume of the smaller solid = 540 mm cube

The volume of the larger solid = 857.5 mm cube

The surface area of the smaller solid = 108 mm sq.

Required to find the surface area of the larger solid =?

Let the surface area of the larger solid be x.

(surface area of smaller solid) / (volume of smaller solid) = (surface area of larger solid) / (volume of larger solid)

Putting the values in the above formula we get the value of x.

108 mm^2 / 540 mm^3 = x / 857.5 mm^3

x = 171.5 mm sq

Thus, the surface area of the larger solid is approximately 172 mm sq

Learn more about the surface area here:

https://brainly.com/question/29298005

#SPJ1

In a group of 150 kids 6 have green eyes 52% have brown eyes 16% have gray eyes and the rest have blue eyes what percentage of the kids have blue eyes.

Answers

Answer:

[tex]\boxed{\boxed{\sf{\:\:\: \green{Percentage = 28\%}\:\:\: }}}[/tex]

[tex]\\[/tex]

Step-by-step explanation:

We know that the total number of kids is 150. We can find the number of kids with green, brown, and gray eyes using the given percentages:

[tex]\sf\dashrightarrow Green\: eyes = 6\: kids[/tex]

[tex]\sf\dashrightarrow Brown\: eyes = 0.52 \times 150 = 78\: kids[/tex]

[tex]\sf\dashrightarrow Gray\: eyes = 0.16 \times 150 = 24\: kids[/tex]

[tex]\\[/tex]

To find the number of kids with blue eyes, we can subtract the number of kids with green, brown, and gray eyes from the total number of kids:

[tex]\sf\dashrightarrow Blue\: eyes = 150 - 6 - 78 - 24[/tex]

[tex]\sf\dashrightarrow Blue\: eyes = 42\: kids[/tex]

[tex]\\[/tex]

Finally, we can calculate the percentage of kids with blue eyes by dividing the number of kids with blue eyes by the total number of kids and multiplying by 100:

[tex]\sf\implies Percentage = \dfrac{42}{150} \times 100[/tex]

[tex]\sf\implies Percentage = \dfrac{4,200}{150}[/tex]

[tex]\sf\implies Percentage = \green{28\%}[/tex]

[tex]\\[/tex]

[tex]\\[/tex]

Therefore, 28% of the kids have blue eyes.

HELP PLS
The equation for the area of a trapezoid is A equals one-half times h times the quantity of b subscript 1 plus b subscript 2 end quantity.. If A = 28, b1 = 6, and b2 = 8, what is the height of the trapezoid?
h = 2
h = 4
h = 6
h = 7

Answers

Answer:

h = 4 units

Step-by-step explanation:

Given equation:

[tex]\text{A}_{\text{trapezoid} } = \dfrac{1}{2}(h)(b_{1} + b_2)[/tex]

Given numerical values:

A = 28b₁ = 6b₂ = 8

Plug in all values into the equation and simplify it to find the height:

[tex]\implies \text{28} = \dfrac{1}{2}(h)(6 + 8)[/tex]

[tex]\implies\text{28} = (h)(3 + 4) = 7h[/tex]

[tex]\implies h = \dfrac{28}{7} = 4[/tex]

Therefore, the measure of the height is 4 units.

Learn more about area of trapezoids: brainly.com/question/15316964

Please help due !!!! Please asap !

Answers

Answer:

hello

the answer to (a) is:

y = kx ----> y = (1/8)x

and the answer to (b) is:

if x = 7

y = (1/8) × 7 = 7/8 or 0.875

Multiply

4 8/9 • 1 1/3

Answers

Answer:

Step-by-step explanation:

[tex]4\frac{8}{9} . 1\frac{1}{3}\\= \frac{44}{9}.\frac{4}{3} \\= \frac{176}{27}[/tex]

Will mark brilliant

14. What information below would be enough to prove ADEF = ARPQ?
E

Answers

The information which would be enough to prove the triangles to be congruent are either DE = RP or ∠F = ∠Q.

Given two triangles,

ΔDEF and ΔRPQ.

If ΔDEF is congruent to ΔRPQ, then the corresponding vertices of D, E and F are R, P and Q respectively.

Already we have from the figure,

∠D = ∠R

DF = RQ

Now, it is enough to prove either DE = RP or ∠F = ∠Q.

When DE = RP, by SAS congruence theorem, corresponding two sides and the included angle of each triangle are equal and thus triangles are congruent.

When ∠F = ∠Q, by ASA congruence theorem, corresponding two angles and the included side of each triangle are equal and thus triangles are congruent.

Hence the information required are either DE = RP or ∠F = ∠Q.

Learn more about Congruence here :

https://brainly.com/question/29188563

#SPJ1

HELP IMAGE ATTACHED ANSWER FAST!! 6) Match the equations to the lines below:

Answers

Answer:

Step-by-step explanation:

In order from top to bottom:

3

2

1

4

3 2 points Find the height of a cone with a diameter of 12 m whose volume is 188 m³. Use 3.14 for 77 and round your answer to the nearest meter. Please record your work/justification on your paper or document

5m
6 m
2m
12 m
4 m​

Answers

5m is the height of a cone with a diameter of 12 m whose volume is 188 m³.

To find the height of a cone, we can use the formula for the volume of a cone and solve for the height.

The formula for the volume of a cone is:

V = (1/3)× π × r² × h

Given that the diameter of the cone is 12 m, the radius (r) is half of the diameter, which is 6 m.

We are also given that the volume of the cone is 188 m³.

Using the formula, we can rearrange it to solve for the height (h):

h = (3V) / (πr²)

Plugging in the values:

h = (3 × 188) / (3.14 × 6²)

h = 564 / (3.14 × 36)

h = 564 / 113.04

h =4.9916

h=5

Therefore, the height of a cone with a diameter of 12 m whose volume is 188 m³ is 5 m.

To learn more on Three dimensional figure click:

https://brainly.com/question/2400003

#SPJ1

I need an equation for the line done in this graph

Answers

change in y/change in x
y=6/4x -4
y=3/2x -4

you purchase a tight sealed container for your sugar cubes to keep the ants away. The container is a rectangular prism with dimensions 6 in by 4 in by 3. The sugar cubes have 0.5 in sides. Is your container big enough to store 560 sugar cubes?

Answers

The container is indeed big enough to store 560 sugar cubes.

To determine if the container is big enough to store 560 sugar cubes, we need to calculate the volume of the container and compare it to the total volume occupied by the sugar cubes.

The volume of a rectangular prism is given by the formula V = lwh, where l is the length, w is the width, and h is the height.

In this case, the dimensions of the container are:

Length (l) = 6 inches

Width (w) = 4 inches

Height (h) = 3 inches

Using the formula, the volume of the container is calculated as follows:

V = 6 inches * 4 inches * 3 inches

V = 72 cubic inches

Now, let's calculate the volume occupied by a single sugar cube:

The side length of a sugar cube is 0.5 inches, so the volume of a single sugar cube is:

V_cube = 0.5 inches * 0.5 inches * 0.5 inches

V_cube = 0.125 cubic inches

To determine the number of sugar cubes that can fit in the container, we divide the volume of the container by the volume of a single sugar cube:

Number of sugar cubes = V_container / V_cube

Number of sugar cubes = 72 cubic inches / 0.125 cubic inches

Number of sugar cubes = 576

Since the number of sugar cubes that can fit in the container is 576, which is greater than the required 560 sugar cubes, we can conclude that the container is indeed big enough to store 560 sugar cubes.

Therefore, the container can comfortably accommodate the desired quantity of sugar cubes while providing a tight seal to keep ants away.

Know more about volume here:

https://brainly.com/question/14197390

#SPJ8

50 Points! Multiple choice algebra question. Photo attached. Thank you!

Answers

The correct option would be (B) if the chances of it raining are 75% then the circle with 75% covered white and the other black that would be the exact thing you need to simulate as the the rest do not match the percentage needed to be accurate
Other Questions
The presence of this Mayan ruin indicates the significant influence of what class of people in Mayan culture? A. Terrace farmers B. Women C. Merchants D. Priests cyclopentadiene can act as a diels-alder diene and as a dienophile. it dimerizes readily to form a diels-alder adduct. draw the structure of the product of cyclopentadiene dimerization. if the elasticity of labor demand is -0.60, then as a result of the decrease in the wage rate, the total labor income will: risk of molybdenum toxicity risk in humans is quite low. true or false Which of the following nuclear reactions requires a high temperature to start and continue?fusionb - emisionfissionbombardmenty - emission June 1 T. James, owner, invested $12,500 cash in Sustain Company.June 2 The company purchased $5,500 of furniture made from reclaimed wood on credit.June 3 The company paid $900 cash for a 12-month prepaid insurance policy on the reclaimed furniture.June 4 The company billed a customer $4,500 for sustainability services provided.June 12 The company paid $5,500 cash toward the payable from the June 2 furniture purchase.June 20 The company collected $4,500 cash for services billed on June 4.June 21 T. James invested an additional $11,500 cash in Sustain Company.June 30 The company received $6,500 cash in advance of providing sustainability services to a customer.Prepare general journal entries for the above transactions.The company purchased $5,500 of furniture made from reclaimed wood on credit. Which of the following is represents an estimate of S edx using rectangles with heights given by right- hand endpoints and four subintervals (i.e. n 4)? Select one: o So e*dx is approximately (0.5)e0.5 + (0.5) + (0.5)1.5 + (0.5)e? o lo e* dx is approximately (0.5) + (0.5)e0.5 + (0.5) + (0.5) 1.5 o e*dx is approximately (0.5)e0.5 + (1)e! + (1.5)e1.5 + (2)e2 o fe*dx is approximately 2e2 Which apparatus can be used to monitor the rate of this reaction? CH3COCH3 (aq) + I2 (aq) CH3COCH2I (aq) + H+ (aq) + I- (aq) I. A pH meter II. A gas syringe III. A colorimeter A I and II only B I and III only C II and III only D I, II and III sucrose (suc) enters the series of reactions in glycolosis after its hydrolysis into glucose (glc) and fructose (fru): when applying linear programming to blending problems, the objective function is usually designed to in a beryllium atom ( z=4 ), how many electrons are in the k shell? express your answer as an integer. Which weather phenomenon is always associated with a thunderstorm?a) lightningb) heavy rainc) hail .Which motherboard form factor allows for low-consumption power supplies?A. Mini-ITXB. EATXC. NLXD. microATX HELP NEED IT TODAY ASAPPolygon ABCD is drawn with vertices A(4, 4), B(4, 6), C(1, 6), D(1, 4). Determine the image coordinates of B if the preimage is reflected across y = 3. B(4, 6) B(4, 12) B(1, 3) B(10, 6) avoiding plagiarism, citing sources, and maintaining academic integrity: for what reason might a company acquire treasury stock? Given the vectors A=i+2j+3k, B= +2j+k and C=4ij, determine x such that A+XB is perpendicular to C. (5 marks) how can someone under 18 open their own brokerage account? The following DNA sequences were used to generate a contig from a genome sequencing project. ttcagattttccccg gctaaagctccgaa gccattaacgcc tttagcatactacggcgtta aaaaccggggaaaat tccgaatcggtcattcaga How long is the fully assembled contig? match the parametric equations with the correct graph. x = cos(8t), y = sin(8t), z = e0.8t, t 0