1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:

Answers

Answer 1
Answer:
mRNA: UAUGCUUUAGCGCUAGCGCCGCUAAGCC

CODONS: AUG-GAA-AUG

AMINO ACIDS: METHIONINE-LEUCINE


Explanation: hope this helps
Answer 2
i am so confused is this an actual question or is it just random letters?-

Related Questions

an adaptation is A a trait that helps an organism survive in its enivironment

Answers

Answer:

True

Explanation:

The given statement is true. An adaptation is any characteristic that helps an organism survive or reproduce. As the environment changes, organisms that inhabit it have to change as well in order to survive. The changes they go through can be physical or behavioral. For example, giraffes have very long necks so that they can reach the leaves of tall trees, and birds have very light bones so that they can fly. This is how species continue to thrive for a very long time.

3. Explain how the Gulf Stream (a warm ocean current) effects the climate of Northern Europe.

Answers

Answer:

These currents transfer heat from the tropics to the polar regions, influencing local and global climate..

The warm Gulf Stream originating in the tropical Caribbean, for instance, carries about 150 times more water than the Amazon River. The current moves along the U.S. East Coast across the Atlantic Ocean towards Europe ...The heat from the Gulf Stream keeps much of Northern Europe significantly warmer than other places equally as far north.

Answer:

The Gulf Stream, located in the north Atlantic Ocean, has an important effect on climate, transportation by sea, and the circulation of nutrients and waste in the ocean. It works together with the North Atlantic Drift to bring warm air from equatorial regions across Europe. This changes Europe’s climate by providing mild temperatures and more rain. As a result, farmers can grow more crops, and fewer freezing temperatures damage goods.

Explanation:

I had a similar question and this was the answer.

A dead organism takes matter out of the ecosystem cycle and that matter
can never be used again. *
O True
False

Answers

Answer:

Decomposers break down dead organisms into nutrients and gases so that they can be used by other organisms. Nutrients can enter or exit an ecosystem at any point and can cycle around the planet.

Answer:

False

Explanation:

If a sample originally had 120 Adams of carbon 14 how many atoms will remain after 17,190 years

Answers

Answer:

15 atoms

Explanation:

About 15 atoms out of the 120 Adams would remain.

Generally, the half-life of a substance is the time it takes for one-half of that substance to disintegrate.

Carbon 14 has a half-life of approximately 5,730 years. 17,190 years means that the sample had stayed for 17,190/5,730 which is equal to 3 carbon-14 half-lives.

Out of 120 Adams,

the first half-life will reduce 120 to 60 Adamsthe second half-life will reduce 60 Adams to 30 Adamsthe third half-life will reduce 30 Adams to 15 Adams.

Hence, at the end of the 17,190 years, approximately 15 Adams would remain.

What is the relationship between a person's PULSE RATE and his or her HEART BEAT? A. The heart beat is always double the pulse rate. B. The heart beat and pulse rate may change, but are always equal. C. The heart beat is always half of the pulse rate. D. There is no relationship between the heart beat and the pulse rate.

Answers

Answer:

B. The heart beat and pulse rate may change, but are always equal.

Hope this helps :D Have a fantastic day

What happens when two
protons get close together?
A. They are attracted to each other.
B. They repel each other.
C. Nothing happens.

Answers

Answer:

they repel each other

Explanation:

in basic chemistry:

protons repel other protons

protons are attracted to electrons

electrons repel electrons

Answer:

B. they repel

Explanation:

I'm learning the same thing lol

What would be the concern if a high percentage of cells were in some phase of Mitosis?

Answers

Answer:

When cell division goes wrong, harmful mutations affect the daughter cells

When these errors are not corrected, one of the daughter cells will be born lacking a particular chromosome while the other will inherit an extra copy of the chromosome

Explanation:

List the 4 types of stress and their initiators.

Answers

Answer:

Time stress, Anticipatory stress, Situational stress, and Encounter stress

The signs of stress are as follows: dizziness, aches or pains, grinding teeth or clenched jaw, headaches, indigestion, increase in or loss of appetite, muscle tension in neck, face or shoulders, problems sleeping

Hope this helps :D Have a great day

Match each underlined word to its correct meaning based on the context of the sentence. Tom had long been picking his way cautiously through this treacherous forest; stepping from tuft to tuft of rushes and roots, which afforded precarious footholds among deep sloughs. It was a dreary memento of the fierce struggle that had taken place in this last foothold of the Indian warriors. He was sulky, however, and would not come to terms: she was to go again with a propitiatory offering, but what it was she forbore to say. At this propitious time of public distress did Tom Walker set up as a usurer in Boston.

Answers

Answer:

A. Tom had long been picking his way cautiously through this treacherous forest;  stepping from tuft to tuft of rushes and roots, which afforded precarious footholds among deep sloughs.  - 3.dangerous.

B. It was a dreary memento of the fierce struggle that had taken place in this last foothold of the Indian warriors. - 4.bleak.

C. He was sulky, however, and would not come to terms: she was to go again with a propitiatory offering,  but what it was she forbore to say. - 2.conciliatory.

D. At this propitious time of public distress did Tom Walker set up as a usurer in Boston. - 1.favorable .

Explanation:

The given underlined words in each sentence are-

1. "Precarious" refers to something unstable, unconfirmed, dangerous, uncertain, unreliable. So, when used in the given sentence, it suggests the dangerousness of the foothold that Tom had to depend on.

2. The word "dreary" is also used for something dull, uninteresting, bleak. It is used to describe the banal, cheerless memento of the fight the Indian warriors had given.

3. "Propitiatory" is another word used to describe something that is like a conciliatory offering, a token of appeasement, or trying to please someone or something. In the given sentence, it is used to describe how she will be offering a conciliatory act to him.

4. The word "propitious" is synonymous with something favorable, advantageous, presenting a promising idea. And in its use, the sentence presents how the public distress is favorable for Tom Walker to set up his office.

Answer:

- 3.dangerous. Tom had long been picking his way cautiously through this treacherous forest;  stepping from tuft to tuft of rushes and roots, which afforded precarious footholds among deep sloughs.

- 4.bleak. It was a dreary memento of the fierce struggle that had taken place in this last foothold of the Indian warriors.

- 2.conciliatory.

He was sulky, however, and would not come to terms: she was to go again with a propitiatory offering,  but what it was she forbore to say.

- 1.favorable . At this propitious time of public distress did Tom Walker set up as a usurer in Boston.

Explanation:

Which of the following is not reflective of Albert Bandura's view on personality? ○Behavior is determined solely by the environment.
○ One's thoughts and behavior can influence the environment.
○Individuals can manipulate their environment to suit personal needs. ○Environment can influence one's behavior through observational learning.

THE ANSWER IS THE FIRST CHOICE-
**Behavior is determined solely by the environment.​

Answers

Answer:

○Behavior is determined solely by the environment.

Explanation:

The above statement is true which happens to be not a reflective of Albert Bandura's view on personality. On the other hand, ones view and personality happens to be influenced by so many factors in which the environment happens to be one of them.

Answer:

the first option

Please someone helpp pleassseee pleaseeee

Answers

Answer:

Honeybees and Flowers

Honeybees and flowers

kareem drew a diagram to compare flatworms and segmented worms

which label belongs in the area marked X?

a. can reproduce sexually
b. are always parasites
c. are all sessile
d. are covered in setae

PLEASE HELP

Answers

Answer:

Explanation:

A - can reproduce sexually

Well, the answer for this question is A.

all the black widow spiders on a 5 acre farm
A. biotic factor
B. population
C. species
D. community

Answers

The answer is B. Population

Species because they group that shares the same traits

List 3 organisms that are made of plant cells:

Answers

Answer:

Seed Plants

Ferns

Mosses

Thallophytes

Explanation:

Why is biodiversity important for ecosystems?

Answers

Answer:to stop from extinction

Explanation:

A. Of the 100 cells shown, how many are in the process of dividing?

Answers

Answer:

Can you show me a picture? I can't answer your question without being able to see a picture or a graph of some sort. Thanks!

Explanation:

All cells in an organism have the same copy of DNA, because they all came from the same orginal cell.
True Or False

Answers

the answer would be true

HELP ASAP
Which statement is true about scientific theories and laws?
A theory can never become a law
If enough evidence is found for theory, it will become a law
Theories have more proof than laws
Only laws are widely accepted by the scientific community

Answers

Answer:

A theory can never become a law

Explanation:

The rest are wrong

Theories can change

Laws cannot

what means biotic component?​

Answers

Any living thing in there please so whether it is the trees or plants or animals anything that is living

Water that falls onto land surfaces is either soaked into the ground or flows downhill into a body of water. The water that soaks into the ground is called groundwater.

Soil and rock that allow this water to pass through them are called ________.
A. aquifers
B. compacted
C. permeable
D. runoff

Answers

Materials that allow water to pass through the are called....

C. Permeable

The capacity of a rock or other substance to let the passage of water is known as permeability, hence option c is correct.

What is groundwater?

Groundwater may readily flow through permeable materials because the pore space is linked throughout the rock or sediment. Mud and clay are examples of materials with great porosity yet very limited permeability.

An aquifer is a water-bearing rock that easily transfers water to wells and springs, the aquifers may be dug into and water pumped out.

Therefore, water that falls onto land surfaces flows into water bodies or it may be soaked in the ground, this water flows through the soil and rock which are permeable, hence option c is correct.

Learn more about rocks, here:

https://brainly.com/question/28175779

#SPJ5

which is more specific chordata or Eukarya​

Answers

Chordata

:):):):):):)

A plant or animal that carries a disease or parasite during part of its life cycle is called a(n):

Answers

Answer:

it could probably be host

Answer:

A plant or animal that carries disease or parasite during part of its life cycle is called a host

I HOPE IT HELPS ❤❤

Please respond quickly!!! This is due soon!

Identify the natural processes that occur on the earth's surface to make and destroy rocks.

Answers

The physical processes on Earth create constant change. These processes—including movement in the tectonic plates in the crust, wind and water erosion, and deposition—shape features on Earth's surface.

Answer:

You learned about the three rock types: igneous, sedimentary, and metamorphic. You also learned that all of these rocks can change. In fact, any rock can change to become any other type of rock. These changes usually happen very slowly. Some changes happen below Earth’s surface. Some changes happen above ground. These changes are all part of the rock cycle. The rock cycle describes each of the main types of rocks, how they form, and how they change.

The figure below shows how the three main rock types are related to each other (Figure below). The arrows within the circle show how one type of rock may change to rock of another type. These are the processes that change one rock type to another rock type.

Explanation:

In a meeting, the presiding officers would like to convince the group on the
importance of a certain mandate but the group seems too passive about it.​

Answers

Answer: Brainstorming meeting

Explanation:

In the brainstorming meeting the agenda of the meeting is put forward. The diverse knowledge, skills, opinions, and background are valued in such meeting. The participants may have distinct opinions and it becomes uneasy to convince the group by the presiding officers. The group members can be passive about the mandate as they may have different perceptions and ideas to tackle a matter.

What controls the cell cycle at key checkpoints?
a Regulatory proteins
b Regulatory lipids
C Regulatory carbohydrates

Answers

Answer:

a regulatory proteins

Explanation:

njnjnj

Is nature or nurture more important

Answers

Answer:

Yes

Explanation:

cus

it keeps us alive

The answer is completely subjective. I’ll assume you are talking about raising children simply because this vocabulary is often used in that case.

Nature can go from describing events out of our control, innate feelings, to describing the area we are raised in. Nature can go a long way with raising kids, in comes the theory’s of the “murder gene.” The aforementioned gene is a theory on the “murderous” behaviors in children sociopaths, or psychopaths. This theory exists because of some unexplainable behaviors the children have that were not taught, like hurting animals and lack of empathy.

In a more lose interpretation of Nature it can mean the area children are raised in. Like the different between a trailer park and a mansion. But generally Nature refers to innate, uncontrollable, behaviors.


On the other hand Nurture refers to the actual raising of the child. Referring back to the “murder gene” the question is if you could reverse the effects of the gene in children based on how you raise them. Nurture is also an argument for how kind you should be to your child as they are growing.

Personally I think Nurture is more important, but in all actuality a good balance is best.

Cathy's favorite salad dressing is a liquid with particles of salt, pepper, and garlic. When comparing a spoonful of salad dressing to a cell, what would the liquid be equivalent to? What would the particles be equivalent to?

Answers

Answer:

Liquid equivalent to "cytoplasm" and the particles equivalent to "organelles".

Explanation:

While comparing a liquid salad dressing to a cell, the liquid will be equivalent to "cytoplasm" because cytoplasm is a thick solution present in each cell that made up of water, salts, and proteins.

The particles would be equivalent to "organelles" because as particles float in liquid salad adding flavours to the salad likewise organelles are present in a cell floating in the cytoplasm that performs a specific function.

Hence, the correct answer is " liquid will be equivalent to "cytoplasm" and the particles will be equal to "organelles".

Can u pls help me this is due today I will give brainliest

Answers

Answer:

exmaple z

Explanation:

it is the heaviest so it would require more to push

this is physics not bio btw

work= force x distance

answer: 8kg

explanation: weight is a force, and the distance is equal in all examples...so the heaviest object is going to need the most work to pull through the distance

what is the next number of the sequence?

0.99, 9.9, 99, 990, ____

Answers

I believe the next number is 9900

Reason: To get the next number in the sequence, move the decimal point

0.99 —> 9.9

9.9 —> 99.

99. —> 990.

990. —> 9900.

Sorry if wrong

11. Cheetahs have been through a genetic bottleneck; evidence for this is that
A little natural selection occurs in this species.
B. the body is long thin, and graceful.
c. there is very little genetic variability.
D. these cats are members of an endangered species.
E. they originally came from sm all areas of Africa.

Answers

Cheetahs have been through a genetic bottleneck; evidence for this is that there is very little genetic variability (Option c).

What is a genetic bottleneck?

A genetic bottleneck is a natural process where a population and/or species lost part of this genetic diversity.

A genetic bottleneck is a process that can be caused by catastrophic natural disasters.

The genetic bottleneck is evidenced by the lack of genetic variability.

In conclusion, cheetahs have been through a genetic bottleneck; evidence for this is that there is very little genetic variability (Option c).

Learn more in:

https://brainly.com/question/8195651

Other Questions
The nth term of a sequence is n-4a) Work out the first three terms of the sequence.b) Work out the tenth term of the sequence. List the nations identified by each letter A BCDEFGHIJKLMNLOOK AT THE PICTURE I PUT FOR THE MAP PLEASE HELP DUE TODAY 1. In terms of its life cycle, which term best describes the sunred giant starO very young starO mid-sequence starO very old star identify the correct research method and explain why it is.does touch affect the physical growth of children?case studycorrelationional studyexperimental studynaturalistic observationsurvey Which of Friar Laurences actions show that he is a mentor for Juliet? Check all that apply.He acts before thinking.He gives Juliet advice to help her situation.He refers to Juliet as daughter, taking on a parental role.He teaches her how to make a sleeping potion.He believes in faking death. 3x -(-2-4x)= What does this equals?? A Nov-Dec power bill shows that a home uses 1355 kwh over a 30-day period. Find the energy used (in kJ) for the 30-day period. 4^3 + (-2) ^4 = ? evaluate? uhm second time? i dont know this question. what is -1 + -1 = ?pls help me Write one example of imagery from the poem, "Annabel Lee". This must be a quote. Three American presidents, Andrew Johnson, Bill Clinton, and Donald Trump havebeen impeached. Impeachment is the investigation that takes place when an electedofficial is accused of illegal activity.The impeachment procedure is an example of what principle?O democracychecks and balanceso three branches of governmentO separation of church and state Select an antonym for the word true dublous assured real valid Can anyone tell me what to write for each box? What is 0.82 as a fraction in simplest form?(I also need the work if not its ok!) 2. Which one of these subjects can be used with the form tienes?tyoMarisollos estudiantes please hellp find x y and z y= 1/6x - 1 Find the slope Simplify {n-1-[n-1-(0 - 1)] I need help. This has to be in within a hour. Question 3, Will mark branliest if helped! What is the area of this figure? *15 m5 m8 m8 m